RegulonDB RegulonDB 10.8: Gene Sequence
aroA gene sequence


Size: 1284        A: 310  T: 322  G: 347  C: 305

Fasta

 

>aroA E. coli K12. Version NC_000913.3 GI:556503834
atggaatccctgacgttacaacccatcgctcgtgtcgatggcactattaatctgcccggt
tccaagagcgtttctaaccgcgctttattgctggcggcattagcacacggcaaaacagta
ttaaccaatctgctggatagcgatgacgtgcgccatatgctgaatgcattaacagcgtta
ggggtaagctatacgctttcagccgatcgtacgcgttgcgaaattatcggtaacggcggt
ccattacacgcagaaggtgccctggagttgttcctcggtaacgccggaacggcaatgcgt
ccgctggcggcagctctttgtctgggtagcaatgatattgtgctgaccggtgagccgcgt
atgaaagaacgcccgattggtcatctggtggatgcgctgcgcctgggcggggcgaagatc
acttacctggaacaagaaaattatccgccgttgcgtttacagggcggctttactggcggc
aacgttgacgttgatggctccgtttccagccaattcctcaccgcactgttaatgactgcg
cctcttgcgccggaagatacggtgattcgtattaaaggcgatctggtttctaaaccttat
atcgacatcacactcaatctgatgaagacgtttggtgttgaaattgaaaatcagcactat
caacaatttgtcgtaaaaggcgggcagtcttatcagtctccgggtacttatttggtcgaa
ggcgatgcatcttcggcttcttactttctggcagcagcagcaatcaaaggcggcactgta
aaagtgaccggtattggacgtaacagtatgcagggtgatattcgctttgctgatgtgctg
gaaaaaatgggcgcgaccatttgctggggcgatgattatatttcctgcacgcgtggtgaa
ctgaacgctattgatatggatatgaaccatattcctgatgcggcgatgaccattgccacg
gcggcgttatttgcaaaaggcaccaccacgctgcgcaatatctataactggcgtgttaaa
gagaccgatcgcctgtttgcgatggcaacagaactgcgtaaagtcggcgcggaagtggaa
gaggggcacgattacattcgtatcactcctccggaaaaactgaactttgccgagatcgcg
acatacaatgatcaccggatggcgatgtgtttctcgctggtggcgttgtcagatacacca
gtgacgattcttgatcccaaatgcacggccaaaacatttccggattatttcgagcagctg
gcgcggattagccaggcagcctga
              
                            

Download fasta file
RegulonDB