RegulonDB RegulonDB 10.8: Gene Sequence
ascB gene sequence


Size: 1425        A: 349  T: 342  G: 400  C: 334

Fasta

 

>ascB E. coli K12. Version NC_000913.3 GI:556503834
atgtcagtatttccagaaagttttttatggggcggcgcgcttgccgccaaccagtctgaa
ggtgcgttccgtgaaggtgacaaaggtctgaccactgtcgatatgatcccacacggcgag
catcgaatggcggtgaaactggggctggaaaaacgttttcagttgcgagatgacgagttt
tatcccagccatgaggcgacggatttttatcatcgttataaagaagatatcgccctgatg
gcagagatgggattcaaggttttccgtacctcaattgcctggagccgtctctttccgcag
ggcgatgaaatcacgcccaatcagcagggcattgctttttatcgttctgtctttgaagag
tgtaaaaagtacggtatcgaaccgctggtcacgttgtgccacttcgatgtgccgatgcat
ctggtcaccgaatatggctcctggcgtaaccgcaagctggtggagtttttcagccgctac
gccagaacctgctttgaagcatttgatggtctggtgaaatactggctaaccttcaatgaa
atcaacattatgttgcatagcccgttctccggcgcgggtctggtgtttgaagaaggtgaa
aatcaggatcaggtgaaatatcaggccgcgcatcaccagctggttgccagtgcgctagcc
accaaaatcgcccatgaggttaacccgcaaaatcaggtgggctgtatgctggcgggcggt
aacttctacccttacagttgcaagccggaagatgtctgggcggcgctggagaaagaccgg
gaaaacctgttttttatcgatgtgcaggcgcggggcacgtatccggcttactctgcccgc
gtattccgcgaaaaaggggtaaccatcaacaaagcaccgggcgatgatgaaatcctgaaa
aacaccgtcgattttgtctctttcagctattacgcctcgcgctgcgcctcggcggagatg
aacgccaacaacagcagtgcggcgaacgtggtgaaatcgctgcgtaatccgtatctacag
gtgagcgactggggctggggaattgatccactcggtctgcgtatcaccatgaatatgatg
tacgatcgttatcagaagccgctgtttctggtggaaaacggcctgggcgcaaaagatgaa
tttgctgccaatggcgagattaacgacgactatcgcatcagctacttacgcgaacatatc
cgcgcaatgggcgaagcgattgcagacggcattccgctgatgggctacaccacatggggc
tgtattgatttagtttccgcctctacgggtgaaatgagcaaacgctacggctttgtcttt
gttgaccgtgacgacgcaggcaacggtacgctgacgcgcacgcgtaagaaatcattctgg
tggtataaaaaagtgattgccagtaatggggaagatttagagtag
              
                            

Download fasta file
RegulonDB