RegulonDB RegulonDB 10.8: Gene Sequence
ascF gene sequence


Size: 1458        A: 297  T: 343  G: 428  C: 390

Fasta

 

>ascF E. coli K12. Version NC_000913.3 GI:556503834
atggccaaaaattatgcggcgctggcacgctcggtgatagcggcactgggcggcgttgat
aacatctcggcggtcacgcactgtatgacgcggttgcgctttgttatcaaagatgatgca
cttatcgacagcccgacgttaaaaaccatccccggcgtgctcggcgtggtacgtagtgac
aaccagtgtcaggtgattatcggcaataccgtttcacaagcctttcaggaagtcgtcagc
ctgctgccgggagatatgcagcccgcacagcccgtgggtaaacccaaactcacgctacgt
cgcattggtgcggggatcctcgatgcgctgatcggcaccatgtcaccgctgatcccggcg
attatcggcggatcgatggtcaaactgctggcaatgatcctcgagatgagcggcgtgctg
acaaaaggatcgccgaccttaaccattctgaatgtgattggtgacggtgctttcttcttc
ctgccgctgatggtcgcggcatctgccgccatcaaatttaaaaccaatatgtcgctggcg
attgccatcgcgggtgtgctggtacatccgagttttattgaactgatggcgaaagcggcc
cagggtgaacatgtcgaatttgccctgattccggtcaccgcggtgaaatacacctacacg
gtgatcccggcgctggtgatgacctggtgcctgtcatatatcgaacgctgggtggacagc
attacaccggcggtgaccaaaaacttcctcaaaccaatgctgattgtgttgattgccgca
ccgctggcaatcctgctgattggcccgattggtatctggatcggtagcgccatttcggcg
ctggtttacaccattcatggttatctgggctggctttcagtcgccattatgggcgcgctg
tggcctctgctggtaatgaccgggatgcaccgcgtctttacgccaaccatcattcagacc
attgccgaaaccggcaaagaagggatggtcatgccgtcagagatcggcgctaacctgtcg
ctgggcggttcatcactggcagtggcgtggaaaacgaaaaacccggaactgcgtcagacg
gcgctggctgcggcggcatcagccattatggcggggatttccgaaccggcgttatatggc
gtggcgatccgcctgaaacgtccgcttatcgccagtcttatcagcggttttatttgcggc
gcggttgccggtatggcggggcttgccagccactcaatggcagcgccggggctatttacc
agcgtgcagttcttcgatccggcgaatccaatgagcatcgtctgggtgttcgcggtcatg
gcgctggcggtggtgctgtcgtttatcctcacactgttgctcggctttgaggatattcct
gttgaggaagcggctgcccaggcgcgaaagtatcagagcgtacaaccgaccgtcgccaaa
gaagtaagtcttaattga
              
                            

Download fasta file
RegulonDB