RegulonDB RegulonDB 10.8: Gene Sequence
asnS gene sequence


Size: 1401        A: 319  T: 348  G: 383  C: 351

Fasta

 

>asnS E. coli K12. Version NC_000913.3 GI:556503834
atgagcgttgtgcctgtagccgacgtactccagggccgtgtagccgttgacagcgaagtc
accgtgcgcggatgggtacgtacccgccgagattcaaaagctggcatctccttcctcgcc
gtttatgacggttcctgctttgatcctgtacaggctgtcatcaataattctctgcccaat
tacaatgaagacgtcctgcgtctgaccaccggctgctcggtcattgtgacgggtaaagtc
gtggcgtcgccgggccaggggcaacaatttgaaattcaggccagcaaggttgaagttgct
ggttgggttgaagatccagacacttacccgatggcggcaaaacgccacagcattgagtat
ctgcgtgaagtcgctcacctgcgtccgcgcacaaacctgattggtgccgtcgcgcgcgtt
cgccatacgctggcgcaggcgctgcatcgcttctttaacgagcagggattcttctgggtt
tcaacgccactgattaccgcatctgataccgaaggtgcaggcgaaatgttccgcgtttct
acgctggatctggaaaacctgccgcgtaacgatcagggcaaagtggatttcgacaaagac
ttctttggtaaagagtctttcctgaccgtatctggccagttgaacggcgaaacctacgct
tgcgcattgtccaaaatttataccttcggcccgactttccgtgctgaaaactccaacacc
agccgtcacctggcggaattctggatgctggagccggaagtggcgtttgctaacctgaac
gatattgcgggtctggctgaagccatgctgaaatatgtcttcaaagcggttctcgaagaa
cgcgctgacgacatgaaattcttcgctgaacgcgtagataaagatgccgtttcacgtctg
gaacgcttcattgaagccgattttgcgcaggtggattataccgacgcagtgaccattctc
gaaaactgcggcaggaagtttgaaaacccggtttactggggagtcgatctctcttctgag
catgagcgttatctggcggaagaacactttaaagcaccggtagtggttaaaaactatccg
aaagatattaaagcgttctatatgcgccttaacgaagacggtaaaaccgttgcggctatg
gacgttctggctccgggcatcggtgagatcattggtggctcccagcgtgaagaacgtctg
gacgtgctggacgagcgtatgctggaaatgggcctgaataaagaagattactggtggtat
cgcgatctgcgtcgctacggtactgttccgcattcaggtttcggtcttggttttgaacgt
ctgattgcttacgtaactggcgtgcaaaacgtacgtgatgtgattccgttcccacgtact
ccgcgtaacgccagcttctaa
              
                            

Download fasta file
RegulonDB