RegulonDB RegulonDB 10.9: Gene Sequence
atpA gene sequence


Size: 1542        A: 355  T: 364  G: 407  C: 416

Fasta

 

>atpA E. coli K12. Version NC_000913.3 GI:556503834
atgcaactgaattccaccgaaatcagcgaactgatcaagcagcgcattgctcagttcaat
gttgtgagtgaagctcacaacgaaggtactattgtttctgtaagtgacggtgttatccgc
attcacggcctggccgattgtatgcagggtgaaatgatctccctgccgggtaaccgttac
gctatcgcactgaacctcgagcgcgactctgtaggtgcggttgttatgggtccgtacgct
gaccttgccgaaggcatgaaagttaagtgtactggccgtatcctggaagttccggttggc
cgtggcctgctgggccgtgtggttaacactctgggtgcaccaatcgacggtaaaggtccg
ctggatcacgacggcttctctgctgtagaagcaatcgctccgggcgttatcgaacgtcag
tccgtagatcagccggtacagaccggttataaagccgttgactccatgatcccaatcggt
cgtggtcagcgtgaattgatcatcggtgaccgtcagacaggtaaaaccgcactggctatc
gatgccatcatcaaccagcgcgattccggtatcaaatgtatctatgtcgctatcggccag
aaagcgtccaccatttctaacgtggtacgtaaactggaagagcacggcgcactggctaac
accatcgttgtggtagcaaccgcgtctgaatccgctgcactgcaatacctggcaccgtat
gccggttgcgcaatgggcgaatacttccgtgaccgcggtgaagatgcgctgatcatttac
gatgacctgtctaaacaggctgttgcttaccgtcagatctccctgctgctccgtcgtccg
ccaggacgtgaagcattcccgggcgacgttttctacctccactctcgtctgctggagcgt
gctgcacgtgttaacgccgaatacgttgaagccttcaccaaaggtgaagtgaaagggaaa
accggttctctgaccgcactgccgattatcgaaactcaggcgggtgacgtttctgcgttc
gttccgaccaacgtaatctccattaccgatggtcagatcttcctggaaaccaacctgttc
aacgccggtattcgtcctgcggttaacccgggtatttccgtatcccgtgttggtggtgca
gcacagaccaagatcatgaaaaaactgtccggtggtatccgtaccgctctggcacagtat
cgtgaactggcagcgttctctcagtttgcatccgaccttgacgatgcaacacgtaagcag
cttgaccacggtcagaaagtgaccgaactgctgaaacagaaacagtatgcgccgatgtcc
gttgcgcagcagtctctggttctgttcgcagcagaacgtggttacctggcggatgttgaa
ctgtcgaaaattggcagcttcgaagccgctctgctggcttacgtcgaccgtgatcacgct
ccgttgatgcaagagatcaaccagaccggtggctacaacgacgaaatcgaaggcaagctg
aaaggcatcctcgattccttcaaagcaacccaatcctggtaa
              
                            

Download fasta file
RegulonDB