RegulonDB RegulonDB 10.9: Gene Sequence
atpD gene sequence


Size: 1383        A: 317  T: 309  G: 392  C: 365

Fasta

 

>atpD E. coli K12. Version NC_000913.3 GI:556503834
atggctactggaaagattgtccaggtaatcggcgccgtagttgacgtcgaattccctcag
gatgccgtaccgcgcgtgtacgatgctcttgaggtgcaaaatggtaatgagcgtctggtg
ctggaagttcagcagcagctcggcggcggtatcgtacgtaccatcgcaatgggttcctcc
gacggtctgcgtcgcggtctggatgtaaaagacctcgaacacccgattgaagtcccggta
ggtaaagcgactctgggccgtatcatgaacgtactgggtgaaccggtcgacatgaaaggc
gagatcggtgaagaagagcgttgggcgattcaccgcgcagcaccttcctacgaagagctg
tcaaactctcaggaactgctggaaaccggtatcaaagttatcgacctgatgtgtccgttc
gctaagggcggtaaagttggtctgttcggtggtgcgggtgtaggtaaaaccgtaaacatg
atggagctcattcgtaacatcgcgatcgagcactccggttactctgtgtttgcgggcgta
ggtgaacgtactcgtgagggtaacgacttctaccacgaaatgaccgactccaacgttatc
gacaaagtatccctggtgtatggccagatgaacgagccgccgggaaaccgtctgcgcgtt
gctctgaccggtctgaccatggctgagaaattccgtgacgaaggtcgtgacgttctgctg
ttcgttgacaacatctatcgttacaccctggccggtacggaagtatccgcactgctgggc
cgtatgccttcagcggtaggttatcagccgaccctggcggaagagatgggcgttctgcag
gaacgtatcacctccaccaaaactggttctatcacctccgtacaggcagtatacgtacct
gcggatgacttgactgacccgtctccggcaaccacctttgcgcaccttgacgcaaccgtg
gtactgagccgtcagatcgcgtctctgggtatctacccggccgttgacccgctggactcc
accagccgtcagctggacccgctggtggttggtcaggaacactacgacaccgcgcgtggc
gttcagtccatcctgcaacgttatcaggaactgaaagacatcatcgccatcctgggtatg
gatgaactgtctgaagaagacaaactggtggtagcgcgtgctcgtaagatccagcgcttc
ctgtcccagccgttcttcgtggcagaagtattcaccggttctccgggtaaatacgtctcc
ctgaaagacaccatccgtggctttaaaggcatcatggaaggcgaatacgatcacctgccg
gagcaggcgttctacatggtcggttccatcgaagaagctgtggaaaaagccaaaaaactt
taa
              
                            

Download fasta file
RegulonDB