RegulonDB RegulonDB 10.9: Gene Sequence
atpE gene sequence


Size: 240        A: 40  T: 70  G: 76  C: 54

Fasta

 

>atpE E. coli K12. Version NC_000913.3 GI:556503834
atggaaaacctgaatatggatctgctgtacatggctgccgctgtgatgatgggtctggcg
gcaatcggtgctgcgatcggtatcggcatcctcgggggtaaattcctggaaggcgcagcg
cgtcaacctgatctgattcctctgctgcgtactcagttctttatcgttatgggtctggtg
gatgctatcccgatgatcgctgtaggtctgggtctgtacgtgatgttcgctgtcgcgtag
              
                            

Download fasta file
RegulonDB