RegulonDB RegulonDB 10.9: Gene Sequence
atpG gene sequence


Size: 864        A: 220  T: 182  G: 240  C: 222

Fasta

 

>atpG E. coli K12. Version NC_000913.3 GI:556503834
atggccggcgcaaaagagatacgtagtaagatcgcaagcgtccagaacacgcaaaagatc
actaaagcgatggagatggtcgccgcttccaaaatgcgtaaatcgcaggatcgcatggcg
gccagccgtccttatgcagaaaccatgcgcaaagtgattggtcaccttgcacacggtaat
ctggaatataagcacccttacctggaagaccgcgacgttaaacgcgtgggctacctggtg
gtgtcgaccgaccgtggtttgtgcggtggtttgaacattaacctgttcaaaaaactgctg
gcggaaatgaagacctggaccgacaaaggcgttcaatgcgacctcgcaatgatcggctcg
aaaggcgtgtcgttcttcaactccgtgggcggcaatgttgttgcccaggtcaccggcatg
ggggataacccttccctgtccgaactgatcggtccggtaaaagtgatgttgcaggcctac
gacgaaggccgtctggacaagctttacattgtcagcaacaaatttattaacaccatgtct
caggttccgaccatcagccagctgctgccgttaccggcatcagatgatgatgatctgaaa
cataaatcctgggattacctgtacgaacccgatccgaaggcgttgctggataccctgctg
cgtcgttatgtcgaatctcaggtttatcagggcgtggttgaaaacctggccagcgagcag
gccgcccgtatggtggcgatgaaagccgcgaccgacaatggcggcagcctgattaaagag
ctgcagttggtatacaacaaagctcgtcaggccagcattactcaggaactcaccgagatc
gtctcgggggccgccgcggtttaa
              
                            

Download fasta file
RegulonDB