RegulonDB RegulonDB 10.8: Gene Sequence
betA gene sequence


Size: 1671        A: 377  T: 340  G: 490  C: 464

Fasta

 

>betA E. coli K12. Version NC_000913.3 GI:556503834
ttgcaatttgactacatcattattggtgccggctcagccggcaacgttctcgctacccgt
ctgactgaagatccgaatacctccgtgctgctgcttgaagcgggcggcccggactatcgc
tttgacttccgcacccagatgcccgctgccctggcattcccgctacagggtaaacgctac
aactgggcctatgaaacggaacctgaaccgtttatgaataaccgccgcatggagtgcgga
cgcggtaaaggtctgggtggatcgtcgctgatcaacggcatgtgctacatccgtggcaat
gcgctggatctcgataactgggcgcaagaacccggtctggagaactggagctacctcgac
tgcctgccctactaccgcaaggccgagactcgcgatatgggtgaaaacgactatcacggc
ggtgatggcccggtgagcgtcactacctccaaacccggcgtcaatccgctgtttgaagcg
atgattgaagcgggcgtgcaggcgggctacccgcgcacggacgatctcaacggttatcag
caggaaggttttggtccgatggatcgcaccgtcacgccgcagggccgtcgcgccagcacc
gcgcgtggctatctcgatcaggccaaatcgcgtcctaacctgaccattcgtactcacgct
atgaccgatcacatcatttttgacggcaaacgcgcggtgggcgtcgaatggctggaaggc
gacagcaccatcccaacccgcgcaacggccaacaaagaagtgctgttatgtgcaggcgcg
attgcctcaccgcagatcctgcaacgctccggcgtcggcaacgctgaactgctggcggag
tttgatattccgctggtgcatgaattacccggcgtcggcgaaaatcttcaggatcatctg
gagatgtatctgcaatatgagtgcaaagaaccggtttccctctaccctgccctgcagtgg
tggaaccagccgaaaatcggtgcggagtggctgtttggcggcactggcgttggtgccagc
aaccactttgaagcaggtggatttattcgcagccgtgaggaatttgcgtggccgaatatt
cagtaccatttcctgccagtagcgattaactataacggctcgaatgcagtgaaagagcac
ggtttccagtgccacgtcggctcaatgcgctcgccaagccgtgggcatgtgcggattaaa
tcccgcgacccgcaccagcatccggcgattctgtttaactacatgtcgcacgagcaggac
tggcaggagttccgcgacgcaattcgcatcacccgcgagatcatgcatcaacccgcgctg
gatcagtatcgtggccgcgaaatcagccccggtgtcgaatgccagacggatgaacagctc
gatgagttcgtgcgtaaccacgccgaaaccgccttccatccgtgcggtacctgcaaaatg
ggttacgacgagatgtccgtggttgacggcgaaggccgcgtacacgggttagaaggcctg
cgtgtggtggatgcgtcgattatgccgcagattatcaccgggaatttgaacgccacgaca
attatgattggcgagaaaatagcggatatgattcgtggacaggaagcgctgccgaggagc
acggcgggatattttgtggcaaatgggatgccggtgagagcgaaaaaatga
              
                            

Download fasta file
RegulonDB