RegulonDB RegulonDB 10.10: Gene Sequence
betI gene sequence


Size: 588        A: 138  T: 116  G: 173  C: 161

Fasta

 

>betI E. coli K12. Version NC_000913.3 GI:556503834
atgcccaaattggggatgcagtcgatccggcgcagacaactgatcgacgccacactggaa
gcaataaatgaagtgggcatgcacgatgcaacgatcgcgcagatcgcccgccgtgcaggc
gtttctacggggatcatcagccactatttcagggacaaaaatggtctgctggaagcaacc
atgcgcgatatcaccagtcagctgcgtgacgcggttttgaatcgattacatgcacttccg
cagggcagtgcagagcagcgattacaggcgattgttggcggaaacttcgatgaaacgcag
gtgagcagtgcggcgatgaaagcctggctggcgttctgggccagcagtatgcatcagccg
atgctctatcgtttacagcaggtcagcagccgccgcttgctgtcgaatctggtgagcgag
tttcgtcgcgaattgccgcgcgaacaggcacaggaagcgggctacggcctggccgcgctg
attgatggattatggctgcgcgcggctctgagcggcaaaccgctggataaaacccgcgct
aattccctgacccgccactttatcactcagcatctacccaccgattaa
              
                            

Download fasta file
RegulonDB