RegulonDB RegulonDB 10.7: Gene Sequence
bglF gene sequence


Size: 1878        A: 406  T: 511  G: 515  C: 446

Fasta

 

>bglF E. coli K12. Version NC_000913.3 GI:556503834
atgacggagttagccagaaaaatagtcgcaggagtcgggggcgcagataacattgtgagt
ctgatgcattgcgcaacgcgattacgttttaaattaaaggatgaaagcaaagcgcaagca
gaggtactgaaaaagacccccggtattattatggtggtggaaagcggtggccagtttcag
gtggtcataggtaaccatgtggccgatgtcttcctggcggttaacagtgtggcaggcctt
gacgaaaaagcgcaacaggcaccggaaaatgatgataaaggtaatctgctaaaccgcttt
gtttatgttatttcaggtatttttacgcctctgatcggtttgatggcggcaaccgggatc
ttgaaaggtatgctggctctggcgctcacttttcagtggacgaccgaacaaagtggtact
tatttaattttattcagcgccagtgatgccttgttttggttcttcccgataatcctggga
tacaccgcggggaaacgcttcggcggtaatccatttactgccatggtgattggtggagcg
ttagtgcatccattaattctgactgctttcgagaacgggcaaaaagcggatgcgctgggg
ctggatttcctgggtattccggtcacattgttgaattactcgtcatcggttattcccatt
attttttctgcctggttgtgcagcattctggaacgccgacttaatgcgtggttaccgtcg
gcaatcaaaaatttcttcacaccattgctatgtctgatggttatcacacccgtcaccttt
ctgctggtggggccgctatcaacctggataagcgaactgattgccgccggttatctctgg
ctttatcaggcggttcctgcatttgcgggcgcggtaatgggcggcttctggcaaatcttc
gtcatgttcggactgcactggggcctggtgccgctgtgtatcaataacttcaccgtgctg
ggctacgacaccatgatcccgctgttaatgcccgccattatggcgcaggtcggggcggcg
ctcggcgtcttcctctgcgaacgcgatgcgcagaaaaaagtggtggcgggatcagcggcg
ttgacgagtctgtttggtatcaccgaaccagcggtatatggcgtcaacctgccgcgtaag
tacccctttgttatcgcctgtatcagtggggctttgggggccaccattattggctacgcg
caaacgaaagtctactcctttggtttgccaagtattttcaccttcatgcaaaccatcccg
tcaacgggaattgatttcaccgtctgggccagcgttattggcggtgtcattgccatcggt
tgcgcatttgtcggtacggtgatgcttcatttcatcaccgctaaacgtcagccagcgcag
ggtgccccgcaagagaaaacaccagaggttattacaccacctgagcagggcggtatctgt
tcaccgatgacgggagagattgtgccgctcattcacgtcgctgataccacgtttgccagt
ggcctgttgggtaaaggtattgccattctgccctcggttggtgaagtgcgttctccggtt
gcgggtcgaattgcttcgttgttcgccacattacacgccattggcattgagtcagatgat
ggtgtggagatcctgattcatgtcggtatcgacaccgtaaaactggacggcaaattcttt
tccgctcacgtcaacgtgggtgacaaggtcaatacaggcgatcggctgatttcttttgat
atccctgctattcgcgaggccggatttgatctgacgacgccggtattaatcagtaatagc
gatgattttacggacgtattaccccacggcacggcgcagataagcgcaggtgaaccgctg
ttatccatcattcgctaa
              
                            

Download fasta file
RegulonDB