RegulonDB RegulonDB 10.10: Gene Sequence
bglG gene sequence


Size: 837        A: 257  T: 221  G: 199  C: 160

Fasta

 

>bglG E. coli K12. Version NC_000913.3 GI:556503834
atgaacatgcaaatcaccaaaattctcaacaataatgttgtggtggttattgatgatcaa
cagcgggaaaaagtcgtcatggggcgcggaattggctttcaaaaacgcgctggcgaaaga
attaactcaagtggaatagaaaaagagtatgccttgagcagtcatgaactgaacgggcga
ttaagcgaactcttaagtcatattcctcttgaggtgatggcaacctgtgatcgtattatc
tctttagcgcaggagcgcttgggaaaattacaggacagtatttatatctcgctaactgac
cattgccagtttgcgattaaacgctttcagcaaaacgtgttgctgcccaacccgttgctg
tgggatatccagcggctttacccgaaagagttccagctaggggaagaagcgttaaccatt
attgataaacggttgggcgtgcagttaccgaaagatgaagtgggctttattgccatgcat
ctggtcagtgcccaaatgagcggaaatatggaggatgttgcaggtgtcacgcagttaatg
cgcgaaatgctgcaattaataaaatttcagttcagccttaattaccaggaagaaagcttg
agttatcagcgactggttacacatctgaagtttttatcctggcgtattcttgaacatgct
tcaattaacgatagtgatgaatcattacaacaagcagtaaaacaaaattacccgcaagca
tggcaatgtgcggaacggatcgccatttttattggtttgcagtatcaacgtaaaatttca
cccgcagagattatgtttttagccataaatatagagcgcgtgcgcaaagaacactga
              
                            

Download fasta file
RegulonDB