RegulonDB RegulonDB 10.9: Gene Sequence
bioB gene sequence


Size: 1041        A: 262  T: 201  G: 305  C: 273

Fasta

 

>bioB E. coli K12. Version NC_000913.3 GI:556503834
atggctcaccgcccacgctggacattgtcgcaagtcacagaattatttgaaaaaccgttg
ctggatctgctgtttgaagcgcagcaggtgcatcgccagcatttcgatcctcgtcaggtg
caggtcagcacgttgctgtcgattaagaccggagcttgtccggaagattgcaaatactgc
ccgcaaagctcgcgctacaaaaccgggctggaagccgagcggttgatggaagttgaacag
gtgctggagtcggcgcgcaaagcgaaagcggcaggatcgacgcgcttctgtatgggcgcg
gcgtggaagaatccccacgaacgcgatatgccgtacctggaacaaatggtgcagggggta
aaagcgatggggctggaggcgtgtatgacgctgggcacgttgagtgaatctcaggcgcag
cgcctcgcgaacgccgggctggattactacaaccacaacctggacacctcgccggagttt
tacggcaatatcatcaccacacgcacttatcaggaacgcctcgatacgctggaaaaagtg
cgcgatgccgggatcaaagtctgttctggcggcattgtgggcttaggcgaaacggtaaaa
gatcgcgccggattattgctgcaactggcaaacctgccgacgccgccggaaagcgtgcca
atcaacatgctggtgaaggtgaaaggcacgccgcttgccgataacgatgatgtcgatgcc
tttgattttattcgcaccattgcggtcgcgcggatcatgatgccaacctcttacgtgcgc
ctttctgccggacgcgagcagatgaacgaacagactcaggcgatgtgctttatggcaggc
gcaaactcgattttctacggttgcaaactgctgaccacgccgaatccggaagaagataaa
gacctgcaactgttccgcaaactggggctaaatccgcagcaaactgccgtgctggcaggg
gataacgaacaacagcaacgtcttgaacaggcgctgatgaccccggacaccgacgaatat
tacaacgcggcagcattatga
              
                            

Download fasta file
RegulonDB