RegulonDB RegulonDB 10.8: Gene Sequence
btuE gene sequence


Size: 552        A: 149  T: 130  G: 156  C: 117

Fasta

 

>btuE E. coli K12. Version NC_000913.3 GI:556503834
atgcaagattccattctgacgaccgtagtgaaagatatcgacggtgaagtgaccacgctg
gagaagttcgccggtaatgtgctgttgattgtcaatgtcgcctcaaagtgtggcttaacg
ccgcaatatgagcagttggagaatattcagaaagcctgggtcgatcgaggttttatggtg
ctgggattcccgtgcaaccagtttctggaacaagaaccgggcagcgatgaagagattaaa
acttactgtaccaccacatggggggtgacgttcccgatgttcagtaagattgaagttaat
ggcgaaggacgccatccgctgtatcaaaaattgattgccgcagcgccgaccgcagtcgcg
ccggaagagagcggattctatgcccgtatggtcagcaaaggccgtgcaccgctgtacccg
gatgatattttatggaattttgaaaaattcctggttggcagggacggaaaagtcatccag
cgtttttccccggatatgacgccggaagatcccattgtgatggaaagcattaaactggcg
ttggcaaaataa
              
                            

Download fasta file
RegulonDB