RegulonDB RegulonDB 10.10: Gene Sequence
cadB gene sequence


Size: 1335        A: 267  T: 408  G: 343  C: 317

Fasta

 

>cadB E. coli K12. Version NC_000913.3 GI:556503834
atgagttctgccaagaagatcgggctatttgcctgtaccggtgttgttgccggtaatatg
atggggagcggtattgcattattacctgcgaacctagcaagtatcggtggtattgctatc
tggggttggattatctctattattggtgcaatgtcgctggcgtatgtatatgcccgactg
gcaacaaaaaacccgcaacaaggtggcccaattgcttatgccggagaaatttcccctgca
tttggttttcagacaggtgttctttattaccatgctaactggattggtaacctggcgatt
ggtattaccgctgtatcttatctttccaccttcttcccagtattaaatgatcctgttccg
gcgggtatcgcctgtattgctatcgtctgggtatttacctttgtaaatatgctcggcggt
acttgggtaagccgtttaaccactattggtctggtgctggttcttattcctgtggtgatg
actgctattgttggctggcattggtttgatgcggcaacttatgcagctaactggaatact
gcggataccactgatggtcatgcgatcattaaaagtattctgctctgcctgtgggccttc
gtgggtgttgaatccgcagctgtaagtactggtatggttaaaaacccgaaacgtaccgtt
ccgctggcaaccatgctgggtactggtttagcaggtattgtttacatcgctgcgactcag
gtgctttccggtatgtatccgtcttctgtaatggcggcttccggtgctccgtttgcaatc
agtgcttcaactatcctcggtaactgggctgcgccgctggtttctgcattcaccgccttt
gcgtgcctgacttctctgggctcctggatgatgttggtaggccaggcaggtgtacgtgcc
gctaacgacggtaacttcccgaaagtttatggtgaagtcgacagcaacggtattccgaaa
aaaggtctgctgctggctgcagtgaaaatgactgccctgatgatccttatcactctgatg
aactctgccggtggtaaagcatctgacctgttcggtgaactgaccggtatcgcagtactg
ctgactatgctgccgtatttctactcttgcgttgacctgattcgttttgaaggcgttaac
atccgcaactttgtcagcctgatctgctctgtactgggttgcgtgttctgcttcatcgcg
ctgatgggcgcaagctccttcgagctggcaggtaccttcatcgtcagcctgattatcctg
atgttctacgctcgcaaaatgcacgagcgccagagccactcaatggataaccacaccgcg
tctaacgcacattaa
              
                            

Download fasta file
RegulonDB