RegulonDB RegulonDB 10.8: Gene Sequence
cadC gene sequence


Size: 1539        A: 458  T: 435  G: 317  C: 329

Fasta

 

>cadC E. coli K12. Version NC_000913.3 GI:556503834
atgcaacaacctgtagttcgcgttggcgaatggcttgttactccgtccataaaccaaatt
agccgcaatgggcgtcaacttacccttgagccgagattaatcgatcttctggttttcttt
gctcaacacagtggcgaagtacttagcagggatgaacttatcgataatgtctggaagaga
agtattgtcaccaatcacgttgtgacgcagagtatctcagaactacgtaagtcattaaaa
gataatgatgaagatagtcctgtctatatcgctactgtaccaaagcgcggctataaatta
atggtgccggttatctggtacagcgaagaagagggagaggaaataatgctatcttcgcct
ccccctataccagaggcggttcctgccacagattctccctcccacagtcttaacattcaa
aacaccgcaacgccacctgaacaatccccagttaaaagcaaacgattcactaccttttgg
gtatggttttttttcctgttgtcgttaggtatctgtgtagcactggtagcgttttcaagt
cttgatacacgtcttcctatgagcaaatcgcgtattttgctcaatccacgcgatattgac
attaatatggtaaataaaagttgtaacagctggagttccccgtatcagctctcttacgcg
ataggcgtgggtgatttggtggcgacatcacttaacaccttctccacctttatggtgcat
gacaaaatcaactacaacattgatgaaccgagcagttccggtaaaacattatctattgcg
tttgttaatcagcgccaataccgtgctcaacaatgctttatgtcgataaaattggtagac
aatgcagatggttcaaccatgctggataaacgttatgtcatcactaacggtaatcagctg
gcgattcaaaatgatttactggagagtttatcaaaagcgttaaaccaaccgtggccacaa
cgaatgcaggagacgctccagaaaattttgccgcatcgtggtgcgttattaactaatttt
tatcaggcacatgattatttactgcatggcgatgataaatcattgaaccgtgccagtgaa
ttattaggtgagattgttcaatcatccccagaatttacctacgcgagagcagaaaaagca
ttagttgatatcgtgcgccattctcaacatcctttagatgaaaaacaattagcagcactg
aacacagaaatagataacattgttacactgccggaattgaacaacctgtccattatatat
caaataaaagcggtcagtgctctggtaaaaggtaaaacagatgagtcttaccaggcgata
aatactggcattgatcttgaaatgtcctggctaaattatgtgttgcttggcaaggtttat
gaaatgaaggggatgaaccgggaagcagctgatgcatatctcaccgcctttaatttacgc
ccaggggcaaacaccctttactggattgaaaatggtatattccagacttctgttccttat
gttgtaccttatctcgacaaatttcttgcttcagaataa
              
                            

Download fasta file
RegulonDB