RegulonDB RegulonDB 10.8: Gene Sequence
carA gene sequence


Size: 1149        A: 283  T: 253  G: 299  C: 314

Fasta

 

>carA E. coli K12. Version NC_000913.3 GI:556503834
ttgattaagtcagcgctattggttctggaagacggaacccagtttcacggtcgggccata
ggggcaacaggttcggcggttggggaagtcgttttcaatacttcaatgaccggttatcaa
gaaatcctcactgatccttcctattctcgtcaaatcgttactcttacttatccccatatt
ggcaatgtcggcaccaatgacgccgatgaagaatcttctcaggtacatgcacaaggtctg
gtgattcgcgacctgccgctgattgccagcaacttccgtaataccgaagacctctcttct
tacctgaaacgccataacatcgtggcgattgccgatatcgatacccgtaagctgacgcgt
ttactgcgcgagaaaggcgcacagaatggctgcattatcgcgggcgataacccggatgcg
gcgctggcgttagaaaaagcccgcgcgttcccaggtctgaatggcatggatctggcaaaa
gaagtgaccaccgcagaagcctatagctggacacaagggagctggacgttgaccggtggc
ctgccagaagcgaaaaaagaagacgagctgccgttccacgtcgtggcttatgattttggt
gccaagcgcaacatcctgcggatgctggtggatagaggctgtcgcctgaccatcgttccg
gcgcaaacttctgcggaagatgtgctgaaaatgaatccagacggcatcttcctctccaac
ggtcctggcgacccggccccgtgcgattacgccattaccgccatccagaaattcctcgaa
accgatattccggtattcggcatctgtctcggtcatcagctgctggcgctggcgagcggt
gcgaagactgtcaaaatgaaatttggtcaccacggcggcaaccatccggttaaagatgtg
gagaaaaacgtggtaatgatcaccgcccagaaccacggttttgcggtggacgaagcaaca
ttacctgcaaacctgcgtgtcacgcataaatccctgttcgacggtacgttacagggcatt
catcgcaccgataaaccggcattcagcttccaggggcaccctgaagccagccctggtcca
cacgacgccgcgccgttgttcgaccactttatcgagttaattgagcagtaccgtaaaacc
gctaagtaa
              
                            

Download fasta file
RegulonDB