RegulonDB RegulonDB 10.8: Gene Sequence
carB gene sequence


Size: 3222        A: 754  T: 655  G: 957  C: 856

Fasta

 

>carB E. coli K12. Version NC_000913.3 GI:556503834
atgccaaaacgtacagatataaaaagtatcctgattctgggtgcgggcccgattgttatc
ggtcaggcgtgtgagtttgactactctggcgcgcaagcgtgtaaagccctgcgtgaagag
ggttaccgcgtcattctggtgaactccaacccggcgaccatcatgaccgacccggaaatg
gctgatgcaacctacatcgagccgattcactgggaagttgtacgcaagattattgaaaaa
gagcgcccggacgcggtgctgccaacgatgggcggtcagacggcgctgaactgcgcgctg
gagctggaacgtcagggcgtgttggaagagttcggtgtcaccatgattggtgccactgcc
gatgcgattgataaagcagaagaccgccgtcgtttcgacgtagcgatgaagaaaattggt
ctggaaaccgcgcgttccggtatcgcacacacgatggaagaagcgctggcggttgccgct
gacgtgggcttcccgtgcattattcgcccatcctttaccatgggcggtagcggcggcggt
atcgcttataaccgtgaagagtttgaagaaatttgcgcccgcggtctggatctctctccg
accaaagagttgctgattgatgagtcgctgatcggctggaaagagtacgagatggaagtg
gtgcgtgataaaaacgacaactgcatcatcgtctgctctatcgaaaacttcgatgcgatg
ggcatccacaccggtgactccatcactgtcgcgccagcccaaacgctgaccgacaaagaa
tatcaaatcatgcgtaacgcctcgatggcggtgctgcgtgaaatcggcgttgaaaccggt
ggttccaacgttcagtttgcggtgaacccgaaaaacggtcgtctgattgttatcgaaatg
aacccacgcgtgtcccgttcttcggcgctggcgtcgaaagcgaccggtttcccgattgct
aaagtggcggcgaaactggcggtgggttacaccctcgacgaactgatgaacgacatcact
ggcggacgtactccggcctccttcgagccgtccatcgactatgtggttactaaaattcct
cgcttcaacttcgaaaaattcgccggtgctaacgaccgtctgaccactcagatgaaatcg
gttggcgaagtgatggcgattggtcgcacgcagcaggaatccctgcaaaaagcgctgcgc
ggcctggaagtcggtgcgactggattcgacccgaaagtgagcctggatgacccggaagcg
ttaaccaaaatccgtcgcgaactgaaagacgcaggcgcagatcgtatctggtacatcgcc
gatgcgttccgtgcgggcctgtctgtggacggcgtcttcaacctgaccaacattgaccgc
tggttcctggtacagattgaagagctggtgcgtctggaagagaaagtggcggaagtgggc
atcactggcctgaacgctgacttcctgcgccagctgaaacgcaaaggctttgccgatgcg
cgcttggcaaaactggcgggcgtacgcgaagcggaaatccgtaagctgcgtgaccagtat
gacctgcacccggtttataagcgcgtggatacctgtgcggcagagttcgccaccgacacc
gcttacatgtactccacttatgaagaagagtgcgaagcgaatccgtctaccgaccgtgaa
aaaatcatggtgcttggcggcggcccgaaccgtatcggtcagggtatcgaattcgactac
tgttgcgtacacgcctcgctggcgctgcgcgaagacggttacgaaaccattatggttaac
tgtaacccggaaaccgtctccaccgactacgacacttccgaccgcctctacttcgagccg
gtaactctggaagatgtgctggaaatcgtgcgtatcgagaagccgaaaggcgttatcgtc
cagtacggcggtcagaccccgctgaaactggcgcgcgcgctggaagctgctggcgtaccg
gttatcggcaccagcccggatgctatcgaccgtgcagaagaccgtgaacgcttccagcat
gcggttgagcgtctgaaactgaaacaaccggcgaacgccaccgttaccgctattgaaatg
gcggtagagaaggcgaaagagattggctacccgctggtggtacgtccgtcttacgttctc
ggcggtcgggcgatggaaatcgtctatgacgaagctgacctgcgtcgctacttccagacg
gcggtcagcgtgtctaacgatgcgccagtgttgctggaccacttcctcgatgacgcggta
gaagttgacgtggatgccatctgcgacggcgaaatggtgctgattggcggcatcatggag
catattgagcaggcgggcgtgcactccggtgactccgcatgttctctgccagcctacacc
ttaagtcaggaaattcaggatgtgatgcgccagcaggtgcagaaactggccttcgaattg
caggtgcgcggcctgatgaacgtgcagtttgcggtgaaaaacaacgaagtctacctgatt
gaagttaacccgcgtgcggcgcgtaccgttccgttcgtctccaaagccaccggcgtaccg
ctggcaaaagtggcggcgcgcgtgatggctggcaaatcgctggctgagcagggcgtaacc
aaagaagttatcccgccgtactactcggtgaaagaagtggtgctgccgttcaataaattc
ccgggcgttgacccgctgttagggccagaaatgcgctctaccggggaagtcatgggcgtg
ggccgcaccttcgctgaagcgtttgccaaagcgcagctgggcagcaactccaccatgaag
aaacacggtcgtgcgctgctttccgtgcgcgaaggcgataaagaacgcgtggtggacctg
gcggcaaaactgctgaaacagggcttcgagctggatgcgacccacggcacggcgattgtg
ctgggcgaagcaggtatcaacccgcgtctggtaaacaaggtgcatgaaggccgtccgcac
attcaggaccgtatcaagaatggcgaatatacctacatcatcaacaccacctcaggccgt
cgtgcgattgaagactcccgcgtgattcgtcgcagtgcgctgcaatataaagtgcattac
gacaccaccctgaacggcggctttgccaccgcgatggcgctgaatgccgatgcgactgaa
aaagtaatttcggtgcaggaaatgcacgcacagatcaaataa
              
                            

Download fasta file
RegulonDB