RegulonDB RegulonDB 10.10: Gene Sequence
chbC gene sequence


Size: 1359        A: 297  T: 393  G: 342  C: 327

Fasta

 

>chbC E. coli K12. Version NC_000913.3 GI:556503834
atgagtaatgttattgcatcgcttgaaaaggtactcctcccttttgcagttaaaatagga
aagcagccacacgttaatgcaatcaaaaatggctttattcgcttaatgccgttaaccctt
gcgggggccatgtttgtattaattaacaacgtttttctaagctttggggaggggtcgttt
ttttattccttaggtattcgcctcgacgcctcaaccattgaaacacttaatggtctgaaa
ggtattggcggcaacgtatataacggaacattaggaataatgtctttaatggcaccgttc
tttattggcatggcgctggcagaagagcgtaaagtcgatgcgctggcggctgggttgtta
tccgttgcagcatttatgaccgtcaccccatatagtgtcggtgaggcctatgcggttggt
gcaaactggttaggtggggcgaatatcatctccgggattattattggcctggtggtggca
gaaatgtttacctttattgtccgccgcaattgggtcattaaactgcccgacagcgtacct
gcttcagtatcgcgttccttctcggcattaattcccggctttattattctttccgtgatg
gggattattgcctgggcgttgaatacctggggcaccaacttccatcagatcattatggat
accatctcaaccccactggcatcgttgggtagcgtggtgggctgggcctatgtgatcttt
gttccactgctctggttcttcggtattcatggcgcgctggcgctgaccgcactggacaac
ggcattatgacgccgtgggcactggaaaatatcgcgacctatcagcaatatggttccgtc
gaagcggcgctggcagccggtaagaccttccatatctgggccaagccgatgctggactcc
tttattttccttgggggcagtggtgcgactttaggcctgatcctggctatctttatcgcc
tctcgccgtgctgattatcgtcaggtggcaaaactggcgctgccgtccggcatcttccag
attaacgaaccgattctgtttggtctgccaattatcatgaacccggtgatgtttatcccg
tttgtactggtacaaccgattctggcggcaatcaccctcgcagcgtactacatgggcatt
attcctccggtgaccaatattgcaccgtggaccatgccaaccggtctgggagccttcttt
aacaccaacggtagcgtcgccgcattgctggtcgcactcttcaaccttggcatcgcaacg
ttaatttatctgccctttgttgtggtggctaacaaagcacaaaatgcgattgataaagaa
gagagcgaagaagatatcgctaacgccctgaaattttaa
              
                            

Download fasta file
RegulonDB