RegulonDB RegulonDB 10.9: Gene Sequence
chbA gene sequence


Size: 351        A: 104  T: 72  G: 105  C: 70

Fasta

 

>chbA E. coli K12. Version NC_000913.3 GI:556503834
atgatggatctcgataacattcccgatacgcaaacggaagctgaagagctggaagaagtg
gtgatggggctgatcatcaactccggacaagcgcgcagcctggcgtatgcggcactgaaa
caggcgaagcagggcgattttgccgcagcaaaagccatgatggatcagtcacggatggca
ttgaatgaagcgcatctggtacagacgaaactgattgaaggcgatgcgggcgaaggtaag
atgaaagtgagtctggtgctggtccacgctcaggatcatttaatgacgtccatgcttgcg
cgtgaactgattactgaattaattgagcttcatgaaaaactgaaggcataa
              
                            

Download fasta file
RegulonDB