RegulonDB RegulonDB 10.9: Gene Sequence
chbR gene sequence


Size: 843        A: 244  T: 249  G: 195  C: 155

Fasta

 

>chbR E. coli K12. Version NC_000913.3 GI:556503834
atgatgcagccagtgattaacgcgccggaaattgccactgcccgagaacagcagttgttt
aatggcaaaaacttccatgtgtttatctataacaaaactgagagtatcagcggactgcat
cagcacgactattatgaatttactctggtattaaccgggcgttatttccaggagattaac
ggtaagcgcgtgttactggaacggggcgattttgtttttattccgttaggttcgcaccat
caaagtttttatgagtttggtgccacgcgcatattgaacgttgggatcagtaaacgcttt
tttgagcagcattacctgccattgttgccttattgctttgtcgcttcgcaggtataccgg
accaataacgcttttctcacctatgtggaaacagtgatttcttcattgaatttccgcgaa
acagggctggaagagtttgttgagatggttactttttatgtcattaaccgtttacgtcat
taccgcgaagaacaggtgattgatgatgtaccgcagtggctgaaaagtacggtagaaaag
atgcatgataaagagcagtttagtgaatcggcgctggagaatatggtggcgttgtcagcc
aaatcacaggaatatttgacgcgagcgactcaacgatattatggcaaaacgccaatgcag
attattaatgaaatccgtattaattttgccaaaaaacaactggaaatgaccaactattca
gtgacggatattgcgtttgaggccggttatagtagcccgagtttgtttattaaaacgttt
aagaaattaacgtcctttacgcctaagagctatcgtaagaaattgactgaatttaatcag
taa
              
                            

Download fasta file
RegulonDB