RegulonDB RegulonDB 10.8: Gene Sequence
cheB gene sequence


Size: 1050        A: 244  T: 236  G: 322  C: 248

Fasta

 

>cheB E. coli K12. Version NC_000913.3 GI:556503834
atgagcaaaatcagggtgttatctgtcgatgattcggcactgatgcgccagatcatgaca
gaaatcatcaacagccatagcgacatggaaatggtggcgaccgcgcctgatccgctggtc
gcgcgtgacttgattaagaaattcaatcccgatgtgctgacgctggatgttgaaatgccg
cggatggacggactggatttcctcgaaaaattaatgcgtttgcgtccaatgcccgttgtg
atggtttcttccctgaccggcaaagggtcagaagtcacgctgcgcgcgctggagctgggg
gcgatagattttgtcaccaaaccgcaactgggtattcgcgaaggtatgctggcgtataac
gaaatgattgctgaaaaggtgcgtacggcagcaaaggcgagccttgcagcacataagcca
ttgtcggcaccgacaacgctgaaggcggggccgttgttgagttctgaaaaactgattgcg
attggtgcttcaacgggtggaactgaggcaattcgtcacgtactgcaaccgttgccgctt
tccagcccggcactgttaattacccagcatatgccgcccggtttcacccgctcttttgcc
gacagacttaataagctttgccagatcggggttaaagaagccgaagacggagaacgtgtc
ttgccggggcatgcctatattgcgccgggcgatcggcatatggagctgtcgcgtagtggc
gcaaattaccaaatcaaaattcacgatggcccggcggttaaccgtcatcggccttcggta
gatgtgttgttccattctgtcgccaaacaggcggggcgtaatgcggttggggtgatcctg
accggtatgggcaacgacggcgcggcgggaatgttggcgatgcgtcaggcgggggcatgg
acccttgcgcaaaacgaagcaagttgcgtggtgttcggcatgccgcgcgaggccatcaat
atgggtggtgtctgcgaagtggtcgatcttagccaggtaagccagcaaatgttggcaaaa
attagtgccggacaggcgatacgtatttaa
              
                            

Download fasta file
RegulonDB