RegulonDB RegulonDB 10.8: Gene Sequence
cheR gene sequence


Size: 861        A: 184  T: 210  G: 242  C: 225

Fasta

 

>cheR E. coli K12. Version NC_000913.3 GI:556503834
atgacttcatctctgccctgtgggcaaacgtctttattgttacagatgaccgagcgcctg
gcgctttccgacgcgcattttcggcggataagtcaattgatctatcaacgagccgggatc
gttctggctgaccataaacgcgacatggtttacaaccgactggttcgtcgtttgcgttcg
ctgggactgacggatttcggtcattatctgaacttgctggaatctaatcagcacagcggt
gagtggcaggcgtttatcaattcgctgaccacgaatctgacggcatttttccgtgaggca
catcatttccctctgctcgcggatcacgcacgtcgccgttctggcgagtatcgcgtatgg
agcgcggcggcttcgaccggcgaagagccgtacagcattgcgatgacgctggctgacaca
ttgggcaccgcgcccggacgctggaaagtgtttgccagtgatatcgacaccgaagtgctg
gaaaaagccagaagcggtatctatcgccatgaagagttgaaaaacctgacgccgcagcaa
ctgcaacggtatttcatgcgagggacggggccgcatgaagggctggtacgcgtgcgtcag
gagctggcgaactatgttgattttgccccgctgaatctactggcgaaacagtacaccgtg
ccggggccgtttgatgcgatcttctgtcgtaacgtcatgatctacttcgatcaaactacc
cagcaggagattttgcgccgctttgttccgctccttaaacccgacggattgctgtttgcg
ggtcactctgaaaactttagccaccttgagcgccgcttcacgctgcgtggtcagacggtg
tatgcgctaagtaaggattaa
              
                            

Download fasta file
RegulonDB