RegulonDB RegulonDB 10.10: Gene Sequence
cheW gene sequence


Size: 504        A: 125  T: 117  G: 152  C: 110

Fasta

 

>cheW E. coli K12. Version NC_000913.3 GI:556503834
atgaccggtatgacgaatgtaacaaagctggccagcgagccgtcaggccaggaatttctg
gtatttacccttggtgatgaagagtacggtattgatatcctgaaagtgcaggagatccgt
ggctacgatcaggtaacacggattgcgaacacgccagcgtttatcaaaggcgtcacgaat
ctgcgcggcgttattgtgccgattgttgacttacgaattaagttcagccaggtggatgtg
gactataacgacaacacggtagttatcgtcctgaatctcggacagcgggtggtcggcatc
gtggttgacggcgtctcagacgtgctttcattgacggcggagcaaattcgtccggcaccg
gaatttgccgtgacgctttcaacagaatatctcactggactgggcgcactgggcgaccgg
atgttgattctggtgaacatcgaaaaactgctgaacagcgaagagatggcgctgttagat
agcgcggcgtcagaagtggcgtaa
              
                            

Download fasta file
RegulonDB