RegulonDB RegulonDB 10.9: Gene Sequence
cheY gene sequence


Size: 390        A: 107  T: 91  G: 118  C: 74

Fasta

 

>cheY E. coli K12. Version NC_000913.3 GI:556503834
atggcggataaagaacttaaatttttggttgtggatgacttttccaccatgcgacgcata
gtgcgtaacctgctgaaagagctgggattcaataatgttgaggaagcggaagatggcgtc
gacgctctcaataagttgcaggcaggcggttatggatttgttatctccgactggaacatg
cccaatatggatggcctggaattgctgaaaacaattcgtgcggatggcgcgatgtcggca
ttgccagtgttaatggtgactgcagaagcgaagaaagagaacatcattgctgcggcgcaa
gcgggggccagtggctatgtggtgaagccatttaccgccgcgacgctggaggaaaaactc
aacaaaatctttgagaaactgggcatgtga
              
                            

Download fasta file
RegulonDB