RegulonDB RegulonDB 10.7: Gene Sequence
crr gene sequence


Size: 510        A: 143  T: 126  G: 128  C: 113

Fasta

 

>crr E. coli K12. Version NC_000913.3 GI:556503834
atgggtttgttcgataaactgaaatctctggtttccgacgacaagaaggataccggaact
attgagatcattgctccgctctctggcgagatcgtcaatatcgaagacgtgccggatgtc
gtttttgcggaaaaaatcgttggtgatggtattgctatcaaaccaacgggtaacaaaatg
gtcgcgccagtagacggcaccattggtaaaatctttgaaaccaaccacgcattctctatc
gaatctgatagcggcgttgaactgttcgtccacttcggtatcgacaccgttgaactgaaa
ggcgaaggcttcaagcgtattgctgaagaaggtcagcgcgtgaaagttggcgatactgtc
attgaatttgatctgccgctgctggaagagaaagccaagtctaccctgactccggttgtt
atctccaacatggacgaaatcaaagaactgatcaaactgtccggtagcgtaaccgtgggt
gaaaccccggttatccgcatcaagaagtaa
              
                            

Download fasta file
RegulonDB