RegulonDB RegulonDB 10.9: Gene Sequence
cyoA gene sequence


Size: 948        A: 243  T: 222  G: 237  C: 246

Fasta

 

>cyoA E. coli K12. Version NC_000913.3 GI:556503834
atgagactcaggaaatacaataaaagtttgggatggttgtcattatttgcaggcactgta
ttgctcagtggctgtaattctgcgctgttagatcccaaaggacagattggtctggagcaa
cgttcactgatactgacggcatttggcctgatgttgattgtcgttattcccgcaatcttg
atggctgttggtttcgcctggaagtaccgtgcgagcaataaagatgctaagtacagcccg
aactggtcacactccaataaagtggaagctgtggtctggacggtacctatcttaatcatc
atcttccttgcagtactgacctggaaaaccactcacgctcttgagcctagcaagccgctg
gcacacgacgagaagcccattaccatcgaagtggtttccatggactggaaatggttcttc
atctacccggaacagggcattgctaccgtgaatgaaatcgctttcccggcgaacactccg
gtgtacttcaaagtgacctccaactccgtgatgaactccttcttcattccgcgtctgggt
agccagatttatgccatggccggtatgcagactcgcctgcatctgatcgccaacgaaccc
ggcacttatgacggtatctccgccagctacagcggcccgggcttctcaggcatgaagttc
aaagctattgcaacaccggatcgcgccgcattcgaccagtgggtcgcaaaagcgaagcag
tcgccgaacaccatgtctgacatggctgcgttcgaaaaactggccgcgcctagcgaatac
aaccaggtggaatatttctccaacgtgaaaccagacttgtttgccgatgtaattaacaag
tttatggctcacggtaagagcatggacatgacccagccagaaggtgagcacagcgcacac
gaaggtatggaaggcatggacatgagccacgcggaatccgcccattaa
              
                            

Download fasta file
RegulonDB