RegulonDB RegulonDB 10.9: Gene Sequence
cysB gene sequence


Size: 975        A: 257  T: 247  G: 234  C: 237

Fasta

 

>cysB E. coli K12. Version NC_000913.3 GI:556503834
atgaaattacaacaacttcgctatattgttgaggtggtcaatcataacctgaatgtctca
tcaacagcggaaggactttacacatcacaacccgggatcagtaaacaagtcagaatgctg
gaagacgagctaggcattcaaattttttcccgaagcggcaagcacctgacgcaggtaacg
ccagcagggcaagaaataattcgtatcgctcgcgaagtcctgtcgaaagtcgatgccata
aaatcggttgccggagagcacacctggccggataaaggttcactgtatatcgccaccacg
catacccaggcacgctacgcattaccaaacgtcatcaaaggctttattgagcgttatcct
cgcgtttctttgcatatgcaccagggctcgccgacacaaattgctgatgccgtctctaaa
ggcaatgctgatttcgctatcgccacagaagcgctgcatctgtatgaagatttagtgatg
ttaccgtgctaccactggaatcgggctattgtagtcactccggatcacccgctggcaggc
aaaaaagccattaccattgaagaactggcgcaatatccgttggtgacatataccttcggc
tttaccggacgttcagaactggatactgcctttaatcgcgcagggttaacgccgcgtatc
gttttcacggcaacggatgctgacgtcattaaaacttacgtccggttagggctgggggta
ggggtcattgccagcatggcggtggatccggtcgccgatcccgaccttgtgcgtgttgat
gctcacgatatcttcagccacagtacaaccaaaattggttttcgccgtagtactttcttg
cgcagttatatgtatgatttcattcagcgttttgcaccgcatttaacgcgtgatgtcgtt
gatgcggctgtcgcattgcgctctaatgaagaaattgaggtcatgtttaaagatataaaa
ctgccggaaaaataa
              
                            

Download fasta file
RegulonDB