RegulonDB RegulonDB 10.9: Gene Sequence
cysH gene sequence


Size: 735        A: 204  T: 158  G: 198  C: 175

Fasta

 

>cysH E. coli K12. Version NC_000913.3 GI:556503834
atgtccaaactcgatctaaacgccctgaacgaactgccgaaggtagatcgcattctggcg
ctggcggaaactaacgccgaactggaaaaactggacgctgaaggccgcgtagcctgggcg
ctggataatctgcccggtgaatatgtactttcttccagctttggcattcaggcggcggtg
agcctgcatctggtgaatcaaattcgcccggatattccggtgatcctcaccgatacgggt
tacttgttcccggaaacctaccgctttattgacgagttaacggacaaactcaagctcaac
ctgaaagtgtaccgtgctaccgaaagcgcagcctggcaggaagcacgctacggaaaactg
tgggagcagggcgttgaaggcattgaaaagtacaatgacatcaacaaagtcgaaccgatg
aaccgggctctgaaagaactgaatgcgcaaacctggtttgctggcctgcgccgtgaacaa
tccggcagtcgtgccaatttaccggtgctggcaattcagcgtggcgtatttaaagtgctg
ccgattatcgactgggataaccgaactatttatcagtacctgcaaaaacatggcctgaaa
tatcacccattatgggatgaaggatatttatcggtgggcgatacccatacaacccgtaaa
tgggaacccggcatggcggaagaagaaacgcgtttctttggcttaaaaagggaatgtggg
ttacacgaagggtaa
              
                            

Download fasta file
RegulonDB