RegulonDB RegulonDB 10.8: Gene Sequence
cysS gene sequence


Size: 1386        A: 336  T: 295  G: 407  C: 348

Fasta

 

>cysS E. coli K12. Version NC_000913.3 GI:556503834
atgctaaaaatcttcaatactctgacacgccaaaaagaggaatttaagcctattcacgcc
ggggaagtcggcatgtacgtgtgtggaatcaccgtttacgatctctgtcatatcggtcac
gggcgtacctttgttgcttttgacgtggttgcgcgctatctgcgtttcctcggctataaa
ctgaagtatgtgcgcaacattaccgatatcgacgacaaaatcatcaaacgcgccaatgaa
aatggcgaaagctttgtggcgatggtggatcgcatgatcgccgaaatgcacaaagatttt
gatgctttgaacattctgcgcccggatatggagccgcgcgcgacgcaccatatcgcagaa
attattgaactcactgaacaactgatcgccaaaggtcacgcttatgtggcggacaacggc
gacgtgatgttcgacgtcccgaccgatccaacttatggcgtgctgtcgcgtcaggatctc
gaccagctgcaggcaggcgcgcgcgttgacgtggtcgacgacaaacgcaacccaatggac
ttcgttctgtggaagatgtcgaaagagggcgaaccgagctggccgtctccgtggggcgcg
ggtcgtcctggctggcacattgaatgttcggcaatgaactgcaagcagctgggtaaccac
tttgatatccacggcggcggttcagacctgatgttcccgcaccacgaaaacgaaatcgcg
cagtccacctgtgcccatgatggtcagtatgtgaactactggatgcactcggggatggtg
atggttgaccgcgagaagatgtccaaatcgctgggtaacttctttaccgtgcgcgatgtg
ctgaaatactacgacgcggaaaccgtgcgttacttcctgatgtcgggccactatcgcagc
cagttgaactacagcgaagagaacctgaagcaggcgcgtgcggcgctggagcgtctctac
actgcgctgcgcggcacagataaaaccgttgcgcctgccggtggcgaagcgtttgaagcg
cgctttattgaagcgatggacgacgatttcaacaccccggaagcctattccgtactgttt
gatatggcgcgtgaagtaaaccgtctgaaagcagaagatatggcagcggcgaatgcaatg
gcatctcacctgcgtaaactttccgctgtattgggcctgctggagcaagaaccggaagcg
ttcctgcaaagcggcgcgcaggcagacgacagcgaagtggctgagattgaagcgttaatt
caacagcgtctggatgcccgtaaagcgaaagactgggcggcggcggatgcggcgcgtgat
cgtcttaacgagatggggatcgtgctggaagatggcccgcaagggaccacctggcgtcgt
aagtaa
              
                            

Download fasta file
RegulonDB