RegulonDB RegulonDB 10.8: Gene Sequence
dapA gene sequence


Size: 879        A: 212  T: 212  G: 246  C: 209

Fasta

 

>dapA E. coli K12. Version NC_000913.3 GI:556503834
atgttcacgggaagtattgtcgcgattgttactccgatggatgaaaaaggtaatgtctgt
cgggctagcttgaaaaaactgattgattatcatgtcgccagcggtacttcggcgatcgtt
tctgttggcaccactggcgagtccgctaccttaaatcatgacgaacatgctgatgtggtg
atgatgacgctggatctggctgatgggcgcattccggtaattgccgggaccggcgctaac
gctactgcggaagccattagcctgacgcagcgcttcaatgacagtggtatcgtcggctgc
ctgacggtaaccccttactacaatcgtccgtcgcaagaaggtttgtatcagcatttcaaa
gccatcgctgagcatactgacctgccgcaaattctgtataatgtgccgtcccgtactggc
tgcgatctgctcccggaaacggtgggccgtctggcgaaagtaaaaaatattatcggaatc
aaagaggcaacagggaacttaacgcgtgtaaaccagatcaaagagctggtttcagatgat
tttgttctgctgagcggcgatgatgcgagcgcgctggacttcatgcaattgggcggtcat
ggggttatttccgttacggctaacgtcgcagcgcgtgatatggcccagatgtgcaaactg
gcagcagaagggcattttgccgaggcacgcgttattaatcagcgtctgatgccattacac
aacaaactatttgtcgaacccaatccaatcccggtgaaatgggcatgtaaggaactgggt
cttgtggcgaccgatacgctgcgcctgccaatgacaccaatcaccgacagtggtcgtgag
acggtcagagcggcgcttaagcatgccggtttgctgtaa
              
                            

Download fasta file
RegulonDB