RegulonDB RegulonDB 10.8: Gene Sequence
dapB gene sequence


Size: 822        A: 187  T: 196  G: 254  C: 185

Fasta

 

>dapB E. coli K12. Version NC_000913.3 GI:556503834
atgcatgatgcaaacatccgcgttgccatcgcgggagccggggggcgtatgggccgccag
ttgattcaggcggcgctggcattagagggcgtgcagttgggcgctgcgctggagcgtgaa
ggatcttctttactgggcagcgacgccggtgagctggccggagccgggaaaacaggcgtt
accgtgcaaagcagcctcgatgcggtaaaagatgattttgatgtgtttatcgattttacc
cgtccggaaggtacgctgaaccatctcgctttttgtcgccagcatggcaaagggatggtg
atcggcactacggggtttgacgaagccggtaaacaagcaattcgtgacgccgctgccgat
attgcgattgtctttgctgccaattttagcgttggcgttaacgtcatgcttaagctgctg
gagaaagcagccaaagtgatgggtgactacaccgatatcgaaattattgaagcacatcat
agacataaagttgatgcgccgtcaggcaccgcactggcaatgggagaggcgatcgcccac
gcccttgataaagatctgaaagattgcgcggtctacagtcgtgaaggccacaccggtgaa
cgtgtgcctggcaccattggttttgccaccgtgcgtgcaggtgacatcgttggtgaacat
accgcgatgtttgccgatattggcgagcgtctggagatcacccataaggcgtccagccgt
atgacatttgctaacggcgcggtaagatcggctttgtggttgagtggtaaggaaagcggt
ctttttgatatgcgagatgtacttgatctcaataatttgtaa
              
                            

Download fasta file
RegulonDB