RegulonDB RegulonDB 10.9: Gene Sequence
dapF gene sequence


Size: 825        A: 168  T: 202  G: 253  C: 202

Fasta

 

>dapF E. coli K12. Version NC_000913.3 GI:556503834
atgcagttctcgaaaatgcatggccttggcaacgattttatggtcgtcgacgcggtaacg
cagaatgtctttttttcaccggagctgattcgtcgcctggctgatcggcacctgggggta
gggtttgaccaactgctggtggttgagccgccgtatgatcctgaactggattttcactat
cgcattttcaatgctgatggcagtgaagtggcgcagtgcggcaacggtgcgcgctgcttt
gcccgttttgtgcgtctgaaaggactgaccaataagcgtgatatccgcgtcagcaccgcc
aacgggcggatggttctgaccgtcaccgatgatgatctggtccgcgtaaatatgggcgaa
cccaacttcgaaccttccgccgtgccgtttcgcgctaacaaagcggaaaagacctatatt
atgcgcgccgccgagcagacaatcttatgcggcgtggtgtcgatgggaaatccgcattgc
gtgattcaggtcgatgatgtcgataccgcggcggtagaaacgcttggtcctgttctggaa
agccacgagcgttttccggagcgcgccaatatcggttttatgcaagtggttaagcgcgag
catattcgtttacgcgtttatgagcgtggggcaggagaaacccaggcctgcggcagcggc
gcgtgtgcggcggttgcagtagggattcagcaaggtttgctggccgaagaagtacgcgtg
gaactccccggcggtcgtcttgatatcgcctggaaaggtccgggtcacccgttatatatg
actggcccggcggtacatgtctacgacggatttattcatctatga
              
                            

Download fasta file
RegulonDB