RegulonDB RegulonDB 10.9: Gene Sequence
deaD gene sequence


Size: 1890        A: 416  T: 424  G: 560  C: 490

Fasta

 

>deaD E. coli K12. Version NC_000913.3 GI:556503834
atggctgaattcgaaaccacttttgcagatctgggcctgaaggctcctatccttgaagcc
cttaacgatctgggttacgaaaaaccatctccaattcaggcagagtgtattccacatctg
ctgaatggccgcgacgttctgggtatggcccagacggggagcggaaaaactgcagcattc
tctttacctctgttgcagaatcttgatcctgagctgaaagcaccacagattctggtgctg
gcaccgacccgcgaactggcggtacaggttgctgaagcaatgacggatttctctaaacac
atgcgcggcgtaaatgtggttgctctgtacggcggccagcgttatgacgtgcaattacgc
gccctgcgtcaggggccgcagatcgttgtcggtactccgggccgtctgctggaccacctg
aaacgtggcactctggacctctctaaactgagcggtctggttctggatgaagctgacgaa
atgctgcgcatgggcttcatcgaagacgttgaaaccattatggcgcagatcccggaaggt
catcagaccgctctgttctctgcaaccatgccggaagcgattcgtcgcattacccgccgc
tttatgaaagagccgcaggaagtgcgcattcagtccagcgtgactacccgtcctgacatc
agccagagctactggactgtctggggtatgcgcaaaaacgaagcactggtacgtttcctg
gaagcggaagattttgatgcggcgattatcttcgttcgtaccaaaaacgcgactctggaa
gtggctgaagctcttgagcgtaacggctacaacagcgccgcgctgaacggtgacatgaac
caggcgctgcgtgaacagacactggaacgcctgaaagatggtcgtctggacatcctgatt
gcgaccgacgttgcagcccgtggcctggacgttgagcgtatcagcctggtagttaactac
gatatcccgatggattctgagtcttacgttcaccgtatcggtcgtaccggtcgtgcgggt
cgtgctggccgcgcgctgctgttcgttgagaaccgcgagcgtcgtctgctgcgcaacatt
gaacgtactatgaagctgactattccggaagtagaactgccgaacgcagaactgctaggc
aaacgccgtctggaaaaattcgccgctaaagtacagcagcagctggaaagcagcgatctg
gatcaataccgcgcactgctgagcaaaattcagccgactgctgaaggtgaagagctggat
ctcgaaactctggctgcggcactgctgaaaatggcacagggtgaacgtactctgatcgta
ccgccagatgcgccgatgcgtccgaaacgtgaattccgtgaccgtgatgaccgtggtccg
cgcgatcgtaacgaccgtggcccgcgtggtgaccgtgaagatcgtccgcgtcgtgaacgt
cgtgatgttggcgatatgcagctgtaccgcattgaagtgggccgcgatgatggtgttgaa
gttcgtcatatcgttggtgcgattgctaacgaaggcgacatcagcagccgttacattggt
aacatcaagctgtttgcttctcactccaccatcgaactgccgaaaggtatgccgggtgaa
gtgctgcaacactttacgcgcactcgcattctcaacaagccgatgaacatgcagttactg
ggcgatgcacagccgcatactggcggtgagcgtcgtggcggtggtcgtggtttcggtggc
gaacgtcgtgaaggcggtcgtaacttcagcggtgaacgccgtgaaggtggccgtggtgat
ggtcgtcgttttagcggcgaacgtcgtgaaggccgcgctccgcgtcgtgatgattctacc
ggtcgtcgtcgtttcggtggtgatgcgtaa
              
                            

Download fasta file
RegulonDB