RegulonDB RegulonDB 11.0: Gene Sequence
flk gene sequence


Size: 996        A: 250  T: 228  G: 255  C: 263

Fasta

 

>flk E. coli K12. Version NC_000913.3 GI:556503834
atgatacaacctatttccggccctcctcctgggcaaccaccaggtcagggagataatctg
ccgtctggcacgggcaatcagcctttatccagtcagcaacgtacttcgctggaaagctta
atgacgaaagtgacctcactgacgcaacagcaaagagcagaactgtgggcgggtatcagg
cacgatattggtctgtcgggagattcaccgctgctttcgcgtcacttccctgccgctgag
cataatctggcgcaacgtctgctggccgcgcaaaaaagccattctgcccgccagctttta
gcgcaattaggggagtatttacgtctggggaataatcgtcaggcggtcacggattatatc
cgtcataactttggtcagacgccgctgaatcagctctcaccggagcaattaaaaaccatt
ctcaccctgttgcaggaagggaagatggttattccgcaaccacagcagcgcgaggcgacc
gaccgtcctttattaccggcggagcacaatgcgctaaaacagctggtgaccaaacttgcg
gcggcaacgggggaacccagcaaacagatctggcaatcgatgctggaactttccggggtg
aaagatggcgagttaattccagcgaaactgtttaaccatctggtgacctggctacaggcg
cgtcagacgctaagccagcaaaatacgccgacgctggaatcactacagatgacgctaaaa
caacctttagatgccagtgaactggcggcgttatcggcatatatccagcaaaaatatggt
ctttctgcgcaatcatcgctttcttctgcccaggccgaggatattcttaatcagctttat
caacggcgggttaaagggattgatccgcgtgttatgcaaccgctgcttaatccttttcca
ccgatgatggacacgttgcaaaatatggcaacgcgtcccgcgctgtggatactgttagtc
gcgattatcctgatgctggtctggctggttcgttaa
              
                            

Download fasta file
RegulonDB