RegulonDB RegulonDB 10.8: Gene Sequence
dmsA gene sequence


Size: 2445        A: 623  T: 533  G: 675  C: 614

Fasta

 

>dmsA E. coli K12. Version NC_000913.3 GI:556503834
atgaaaacgaaaatccctgatgcggtattggctgctgaggtgagtcgccgtggtttggta
aaaacgacagcgatcggcggcctggcaatggccagcagcgcattaacattaccttttagt
cggattgcgcacgctgtcgatagcgccattccaacaaaatcagacgaaaaggttatctgg
agcgcctgtacagttaactgtggtagtcgctgcccgctacgtatgcacgtcgtggacggt
gaaatcaaatatgtcgaaacggacaataccggcgatgacaattacgacggcctgcaccag
gttcgcgcctgcctgcgtgggcgttccatgcgtcgccgtgtctacaatccggaccgcctg
aaatatccgatgaaacgagtcggggcgcgcggtgaaggcaaattcgagcgcattagctgg
gaagaagcctacgacatcatcgcgaccaatatgcagcgcctgatcaaagagtacggcaac
gagtctatctatctgaactatggcaccggtacgctgggcggcaccatgacccgctcctgg
ccgccgggaaataccctggtcgcgcggctgatgaactgctgcggcggctatctgaaccat
tacggcgactactcctccgcgcaaattgcggaaggtttgaactatacctacggcggctgg
gcagatggcaacagcccgtcggatatcgaaaacagtaagctggtagtgctgtttggtaat
aaccctggcgaaacgcgaatgagtggcggtggggtgacttactatcttgaacaggcacgc
cagaaatctaatgcccgcatgatcatcatcgatccgcgctataccgacaccggtgccggg
cgcgaagatgagtggatccctattcgtccgggaacagatgccgcactggttaacggtctg
gcgtacgtcatgatcactgaaaacctggtggatcaggcattcctcgataaatattgcgtt
ggctacgatgagaaaaccctgccagccagtgcgccgaaaaatggccactataaagcttat
attctgggtgaagggccagatggcgtggctaaaacgccggaatgggcctcgcaaatcact
ggtgttccggcagacaaaatcatcaaattggctcgtgaaatcggtagtaccaaaccggcg
tttatcagccagggatggggcccgcagcgtcacgctaacggtgaaatcgcaacccgtgct
atctcgatgctggcgattctgaccggtaacgttggtattaacggaggcaacagcggcgcg
cgtgaaggttcatacagcttaccgtttgtccgtatgccgaccttggaaaacccgatccag
accagcatttcgatgtttatgtggaccgatgccattgaacgtggcccggaaatgacggcg
ctgcgtgatggtgtacgcgggaaagataagctggatgtgccgatcaaaatgatctggaac
tatgccggtaactgcctgattaaccagcattctgaaatcaaccgtacccatgaaatcctt
caggatgataagaagtgcgagctgattgtggttatcgactgccacatgacctcatcggcg
aaatatgctgacatcctgctgcctgactgcaccgcttccgaacagatggactttgcgctg
gatgcatcctgcgggaatatgtcttacgtgattttcaacgatcaggtgattaaaccgcgc
tttgaatgtaagaccatctatgaaatgaccagcgaactggcaaaacgtcttggcgttgag
caacagtttactgaaggccgtacccaggaagagtggatgcggcatctgtatgcccagtcg
cgggaagcgattcctgaactgccaacgtttgaagagttccgcaagcaggggatctttaaa
aagcgcgacccacaagggcatcacgttgcttataaagccttccgtgaagatccgcaggca
aacccactgactacgccatcgggcaaaattgagatttattcgcaggcgctggctgacatt
gccgctacctgggaattgcctgaaggcgatgtgatcgatccactgccgatctacacgccg
ggctttgaaagttatcaggatccgctgaacaaacagtatccgctgcagcttacaggtttc
cactataaatctcgcgttcactcaacttacggcaacgttgatgtgctgaaagcggcttgc
cgtcaggaaatgtggatcaacccgcttgatgcccaaaaacgcggtatccacaacggcgat
aaagtcaggatctttaacgatcgtggtgaggttcatattgaggcgaaagtgacgccacga
atgatgccgggtgtggtcgcactgggtgaaggtgcctggtatgacccggatgcaaaacgt
gtcgataagggtggttgtattaacgtactgaccactcaacgtccgtctcctctcgctaag
gggaatccgtcacatacaaaccttgttcaggttgaaaaggtgtaa
              
                            

Download fasta file
RegulonDB