RegulonDB RegulonDB 10.8: Gene Sequence
dmsB gene sequence


Size: 618        A: 150  T: 148  G: 170  C: 150

Fasta

 

>dmsB E. coli K12. Version NC_000913.3 GI:556503834
atgacaacccagtatggattttttattgattccagccgttgcaccggttgcaaaacctgc
gagctggcctgtaaagactacaaagatttgacgccagaagtcagcttccgccgcatttat
gaatatgctggcggcgactggcaggaagataacggtgtctggcaccagaacgtgtttgcc
tactatctgtcgatttcatgtaaccactgcgaagatccggcttgtactaaagtctgcccg
agcggtgcgatgcataaacgtgaagatggttttgttgtggtcgatgaagatgtgtgcatt
ggctgccgctactgccatatggcttgcccgtatggcgcaccgcaatataacgaaacgaaa
ggccatatgaccaaatgcgatggttgttatgaccgtgttgcggagggtaaaaagccgatc
tgtgttgaatcttgtccgctgcgggcgctggatttcggccctatcgacgagctgcgtaaa
aaacatggcgatctggcggccgttgcgccgttgccgcgagctcactttaccaaaccgaat
attgtgatcaaacccaatgccaatagccgcccgaccggggataccactggctatctggca
aacccgaaggaggtgtga
              
                            

Download fasta file
RegulonDB