RegulonDB RegulonDB 10.8: Gene Sequence
dmsC gene sequence


Size: 864        A: 143  T: 249  G: 272  C: 200

Fasta

 

>dmsC E. coli K12. Version NC_000913.3 GI:556503834
atgggaagtggatggcatgaatggccgctgatgatcttcacggtcttcgggcaatgtgta
gcaggtggttttatcgttctggctttggcgctgctcaaaggcgacctgcgagcagaagcc
cagcagcgtgttatcgcctgcatgtttggtttatgggtgctgatgggcattggctttatc
gcctctatgctccatcttggttcaccaatgcgcgcttttaactcgctcaaccgggtaggg
gcttcagcactcagtaacgaaatcgccagcggttcgatcttttttgccgtaggcggcatc
ggctggttgctggcaatgctgaaaaagctgtcaccggcattgcgtacgctgtggctgata
gtgacgatggttcttggcgtcatctttgtctggatgatggtgcgtgtgtataacagcatt
gataccgttccgacctggtacagcatctggacgccgatgggcttcttcctgacgatgttt
atgggcggcccgttactgggttacctgttgttgagtctggctggcgtcgatggctgggcg
atgcgtctgctgccagcaatttctgtactggcactggtagtgagtggcgtggtgtcagtg
atgcagggcgcagagctggcgactattcatagttctgtgcagcaggccgcagcgctggtg
ccggactatggtgcgctgatgtcctggcggatcgtgcttttggccgttgccctgtgcttg
tggattgcaccacagctaaaaggttatcagcctgcggttccgctactttctgtatcattc
attctgcttctggcaggggaattaatcggtcgcggcgtattctatggtttgcatatgacc
gtggggatggccgtcgcaagctaa
              
                            

Download fasta file
RegulonDB