RegulonDB RegulonDB 10.9: Gene Sequence
dnaA gene sequence


Size: 1404        A: 340  T: 305  G: 387  C: 372

Fasta

 

>dnaA E. coli K12. Version NC_000913.3 GI:556503834
gtgtcactttcgctttggcagcagtgtcttgcccgattgcaggatgagttaccagccaca
gaattcagtatgtggatacgcccattgcaggcggaactgagcgataacacgctggccctg
tacgcgccaaaccgttttgtcctcgattgggtacgggacaagtaccttaataatatcaat
ggactgctaaccagtttctgcggagcggatgccccacagctgcgttttgaagtcggcacc
aaaccggtgacgcaaacgccacaagcggcagtgacgagcaacgtcgcggcccctgcacag
gtggcgcaaacgcagccgcaacgtgctgcgccttctacgcgctcaggttgggataacgtc
ccggccccggcagaaccgacctatcgttctaacgtaaacgtcaaacacacgtttgataac
ttcgttgaaggtaaatctaaccaactggcgcgcgcggcggctcgccaggtggcggataac
cctggcggtgcctataacccgttgttcctttatggcggcacgggtctgggtaaaactcac
ctgctgcatgcggtgggtaacggcattatggcgcgcaagccgaatgccaaagtggtttat
atgcactccgagcgctttgttcaggacatggttaaagccctgcaaaacaacgcgatcgaa
gagtttaaacgctactaccgttccgtagatgcactgctgatcgacgatattcagtttttt
gctaataaagaacgatctcaggaagagtttttccacaccttcaacgccctgctggaaggt
aatcaacagatcattctcacctcggatcgctatccgaaagagatcaacggcgttgaggat
cgtttgaaatcccgcttcggttggggactgactgtggcgatcgaaccgccagagctggaa
acccgtgtggcgatcctgatgaaaaaggccgacgaaaacgacattcgtttgccgggcgaa
gtggcgttctttatcgccaagcgtctacgatctaacgtacgtgagctggaaggggcgctg
aaccgcgtcattgccaatgccaactttaccggacgggcgatcaccatcgacttcgtgcgt
gaggcgctgcgcgacttgctggcattgcaggaaaaactggtcaccatcgacaatattcag
aagacggtggcggagtactacaagatcaaagtcgcggatctcctttccaagcgtcgatcc
cgctcggtggcgcgtccgcgccagatggcgatggcgctggcgaaagagctgactaaccac
agtctgccggagattggcgatgcgtttggtggccgtgaccacacgacggtgcttcatgcc
tgccgtaagatcgagcagttgcgtgaagagagccacgatatcaaagaagatttttcaaat
ttaatcagaacattgtcatcgtaa
              
                            

Download fasta file
RegulonDB