RegulonDB RegulonDB 10.9: Gene Sequence
dppA gene sequence


Size: 1608        A: 438  T: 341  G: 415  C: 414

Fasta

 

>dppA E. coli K12. Version NC_000913.3 GI:556503834
atgcgtatttccttgaaaaagtcagggatgctgaagcttggtctcagcctggtggctatg
accgtcgcagcaagtgttcaggctaaaactctggtttattgctcagaaggatctccggaa
gggtttaacccgcagctgtttacctccggcaccacctatgacgcctcttccgtcccgctt
tataaccgtctggttgaatttaaaatcggcaccaccgaagtgatcccgggcctcgctgaa
aagtgggaagtcagcgaagacggtaaaacctataccttccatctgcgtaaaggtgtgaag
tggcacgacaataaagaattcaaaccgacgcgtgaactgaacgccgatgatgtggtgttc
tcgttcgatcgtcagaaaaacgcgcaaaacccgtaccataaagtttctggcggcagctac
gaatacttcgaaggcatgggcttgccagagctgatcagtgaagtgaaaaaggtggacgac
aacaccgttcagtttgtgctgactcgcccggaagcgccgttcctcgctgacctggcaatg
gacttcgcctctattctgtcaaaagaatatgctgatgcgatgatgaaagccggtacaccg
gaaaaactggacctcaacccaatcggaaccggtccgttccagttacagcagtatcaaaaa
gattcccgtatccgctacaaagcgtttgatggctactggggcaccaaaccgcagatcgat
acgctggttttctctattacccctgacgcttccgtgcgttacgcgaaattgcagaagaat
gaatgccaggtgatgccgtacccgaacccggcagatatcgctcgcatgaagcaggataaa
tccatcaatctgatggaaatgccggggctgaacgtcggttatctctcgtataacgtgcag
aaaaaaccactcgatgacgtgaaagttcgccaggctctgacctacgcggtgaacaaagac
gcgatcatcaaagcggtttatcagggcgcgggcgtatcagcgaaaaacctgatcccgcca
accatgtggggctataacgacgacgttcaggactacacctacgatcctgaaaaagcgaaa
gccttgctgaaagaagcgggtctggaaaaaggtttctccatcgacctgtgggcgatgccg
gtacaacgtccgtataacccgaacgctcgccgcatggcggagatgattcaggcagactgg
gcgaaagtcggcgtgcaggccaaaattgtcacctacgaatggggtgagtacctcaagcgt
gcgaaagatggcgagcaccagacggtaatgatgggctggactggcgataacggggatccg
gataacttcttcgccaccctgttcagctgcgccgcctctgaacaaggctccaactactca
aaatggtgctacaaaccgtttgaagatctgattcaaccggcgcgtgctaccgacgaccac
aataaacgcgttgaactgtacaaacaagcgcaggtggtgatgcacgatcaggctccggca
ctgatcatcgctcactccaccgtgtttgaaccggtacgtaaagaagttaaaggctatgtg
gttgatccattaggcaaacatcacttcgaaaacgtctctatcgaataa
              
                            

Download fasta file
RegulonDB