RegulonDB RegulonDB 10.9: Gene Sequence
ebgA gene sequence


Size: 3093        A: 729  T: 677  G: 824  C: 863

Fasta

 

>ebgA E. coli K12. Version NC_000913.3 GI:556503834
atgaatcgctgggaaaacattcagctcacccacgaaaaccgacttgcgccgcgtgcgtac
tttttttcatatgattctgttgcgcaagcgcgtacctttgcccgcgaaaccagcagcctg
tttctgcccttaagcggtcagtggaatttccacttttttgaccatccgctgcaagtacca
gaagccttcacctctgagttaatggctgactgggggcatattaccgtccccgccatgtgg
caaatggaaggtcacggcaaactgcaatataccgacgaaggttttccgttccccatcgat
gtgccgtttgtccccagcgataacccaaccggtgcctatcaacgtattttcaccctcagc
gacggctggcagggtaaacagacgctgattaaatttgacggcgtcgaaacctattttgaa
gtctatgttaacggtcagtatgtgggtttcagcaagggcagtcgcctgaccgcagagttt
gacatcagcgcgatggttaaaaccggcgacaacctgttgtgtgtgcgcgtgatgcagtgg
gcggactctacctacgtggaagaccaggatatgtggtggtcagcggggatcttccgcgat
gtttatctggtcggaaaacacctaacgcatattaacgatttcactgtgcgtaccgacttt
gacgaagcctattgcgatgccacgctttcctgcgaagtggtgctggaaaatctcgccgcc
tcccctgtcgtcacgacgctggaatataccctgtttgatggcgaacgcgtggtgcacagc
agcgccattgatcatttggcaattgaaaaactgaccagcgccagctttgcttttactgtc
gaacagccgcagcaatggtcagcagaatccccttatctttaccatctggtcatgacgctg
aaagacgccaacggcaacgttctggaagtggtgccacaacgcgttggcttccgtgatatc
aaagtgcgcgacggtctgttctggatcaataaccgttatgtgatgctgcacggcgtcaac
cgtcacgacaacgatcatcgcaaaggccgcgccgttggaatggatcgcgtcgagaaagat
ctccagttgatgaagcagcacaatatcaactccgtgcgtaccgctcactacccgaacgat
ccgcgtttttacgaactgtgtgatatctacggcctgtttgtgatggcggaaaccgacgtc
gaatcgcacggctttgctaatgtcggcgatattagccgtattaccgacgatccgcagtgg
gaaaaagtctacgtcgagcgcattgttcgccatatccacgcgcagaaaaaccatccgtcg
atcatcatctggtcgctgggcaatgaatccggctatggctgtaacatccgcgcgatgtac
catgcggcgaaagcgctggatgacacgcgactggtgcattacgaagaagatcgcgatgct
gaagtggtcgatattatttccaccatgtacacccgcgtgccgctgatgaatgagtttggt
gaatacccgcatccgaagccgcgcatcatctgtgaatatgctcatgcgatggggaacgga
ccgggcgggctgacggagtaccagaacgtcttctataagcacgattgcattcagggtcat
tatgtctgggagtggtgcgaccacgggatccaggcacaggacgaccacggcaatgtctgg
tataaattcggcggcgactacggcgactatcccaacaactataacttctgtcttgatggt
ttgatctattccgatcagacgccgggaccgggcctgaaagagtacaaacaggttatcgcg
ccggtaaaaatccacgcgcgggatctgactcgcggcgagttgaaagtcgaaaataaactg
tggtttaccacgcttgatgactacaccctgcacgcagaggtgcgcgccgaaggtgaaacg
ctcgcgacgcagcagattaaactgcgcgacgttgcgccgaacagcgaagcccccttgcag
atcacgctgccgcagctggacgcccgcgaagcgttcctcaacattacggtgaccaaagat
tcccgcacccgctacagcgaagccggacaccctatcgccacttatcagttcccgctgaag
gaaaacaccgcgcagccagtgcctttcgcaccaaataatgcgcgtccgctgacgctggaa
gacgatcgtttgagctgcaccgttcgcggctacaacttcgcgatcaccttctcaaaaatg
agtggcaaaccgacatcctggcaggtgaatggcgaatcgctgctgactcgcgagccaaag
atcaacttcttcaagccgatgatcgacaaccacaagcaggagtacgaagggctgtggcaa
ccgaatcatttgcagatcatgcaggaacatctgcgcgactttgccgtagaacagagcgat
ggtgaagtgctgatcatcagccgcacagttattgccccgccggtgtttgacttcgggatg
cgctgcacctacatctggcgcatcgctgccgatggccaggttaacgtggcgctttccggc
gagcgttacggcgactatccgcacatcattccgtgcatcggtttcaccatgggaattaac
ggcgaatacgatcaggtggcgtattacggtcgtggaccgggcgaaaactacgccgacagc
cagcaggctaacatcatcgatatctggcgcagcaccgtcgatgccatgttcgagaactat
cccttcccgcagaacaacggtaaccgtcagcatgtccgctggacggcactgactaaccgc
cacggtaacggtctgctggtggttccgcagcgcccaattaacttcagcgcctggcactat
acccaggaaaacatccacgctgcccagcactgtaacgagctgcagcgcagtgatgacatc
accctgaacctcgatcaccagctgcttggcctcggctccaactcctggggcagcgaggtg
ctggactcctggcgcgtctggttccgtgacttcagctacggctttacgttgctgccggtt
tctggcggagaagctaccgcgcaaagcctggcgtcgtatgagttcggcgcagggttcttt
tccacgaatttgcacagcgagaataagcaatga
              
                            

Download fasta file
RegulonDB