RegulonDB RegulonDB 10.9: Gene Sequence
ebgC gene sequence


Size: 450        A: 138  T: 107  G: 107  C: 98

Fasta

 

>ebgC E. coli K12. Version NC_000913.3 GI:556503834
atgaggatcatcgataacttagaacagttccgccagatttacgcctctggcaagaagtgg
caacgctgcgttgaagcgattgaaaatatcgacaacattcagcctggcgtcgcccactcc
atcggtgactcattgacttaccgcgtggagacagactccgcgaccgatgcgctatttacc
gggcatcgacgctattttgaagtgcattactacctgcaagggcagcaaaaaattgaatat
gcgccgaaagagacattacaggtagtggaatattatcgtgatgaaactgaccgtgaatat
ttaaaaggctgcggagaaaccgttgaggtccacgaagggcaaatcgttatttgcgatatc
catgaagcgtatcggtttatctgcaataacgcggtcaaaaaagtggttctcaaagtcacc
atcgaagatggttatttccataacaaataa
              
                            

Download fasta file
RegulonDB