RegulonDB RegulonDB 10.7: Gene Sequence
eda gene sequence


Size: 642        A: 139  T: 142  G: 202  C: 159

Fasta

 

>eda E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaactggaaaacaagtgcagaatcaatcctgaccaccggcccggttgtaccggtt
atcgtggtaaaaaaactggaacacgcggtgccgatggcaaaagcgttggttgctggtggg
gtgcgcgttctggaagtgactctgcgtaccgagtgtgcagttgacgctatccgtgctatc
gccaaagaagtgcctgaagcgattgtgggtgccggtacggtgctgaatccacagcagctg
gcagaagtcactgaagcgggtgcacagttcgcaattagcccgggtctgaccgagccgctg
ctgaaagctgctaccgaagggactattcctctgattccggggatcagcactgtttccgaa
ctgatgctgggtatggactacggtttgaaagagttcaaattcttcccggctgaagctaac
ggcggcgtgaaagccctgcaggcgatcgcgggtccgttctcccaggtccgtttctgcccg
acgggtggtatttctccggctaactaccgtgactacctggcgctgaaaagcgtgctgtgc
atcggtggttcctggctggttccggcagatgcgctggaagcgggcgattacgaccgcatt
actaagctggcgcgtgaagctgtagaaggcgctaagctgtaa
              
                            

Download fasta file
RegulonDB