RegulonDB RegulonDB 10.7: Gene Sequence
edd gene sequence


Size: 1812        A: 405  T: 435  G: 523  C: 449

Fasta

 

>edd E. coli K12. Version NC_000913.3 GI:556503834
atgaatccacaattgttacgcgtaacaaatcgaatcattgaacgttcgcgcgagactcgc
tctgcttatctcgcccggatagaacaagcgaaaacttcgaccgttcatcgttcgcagttg
gcatgcggtaacctggcacacggtttcgctgcctgccagccagaagacaaagcctctttg
aaaagcatgttgcgtaacaatatcgccatcatcacctcctataacgacatgctctccgcg
caccagccttatgaacactatccagaaatcattcgtaaagccctgcatgaagcgaatgcg
gttggtcaggttgcgggcggtgttccggcgatgtgtgatggtgtcacccaggggcaggat
ggaatggaattgtcgctgctaagccgcgaagtgatagcgatgtctgcggcggtggggctg
tcccataacatgtttgatggtgctctgttcctcggtgtgtgcgacaagattgtcccgggt
ctgacgatggcagccctgtcgtttggtcatttgcctgcggtgtttgtgccgtctggaccg
atggcaagcggtttgccaaataaagaaaaagtgcgtattcgccagctttatgccgaaggt
aaagtggaccgcatggccttactggagtcagaagccgcgtcttaccatgcgccgggaaca
tgtactttctacggtactgccaacaccaaccagatggtggtggagtttatggggatgcag
ttgccaggctcttcttttgttcatccggattctccgctgcgcgatgctttgaccgccgca
gctgcgcgtcaggttacacgcatgaccggtaatggtaatgaatggatgccgatcggtaag
atgatcgatgagaaagtggtggtgaacggtatcgttgcactgctggcgaccggtggttcc
actaaccacaccatgcacctggtggcgatggcgcgcgcggccggtattcagattaactgg
gatgacttctctgacctttctgatgttgtaccgctgatggcacgtctctacccgaacggt
ccggccgatattaaccacttccaggcggcaggtggcgtaccggttctggtgcgtgaactg
ctcaaagcaggcctgctgcatgaagatgtcaatacggtggcaggttttggtctgtctcgt
tatacccttgaaccatggctgaataatggtgaactggactggcgggaaggggcggaaaaa
tcactcgacagcaatgtgatcgcttccttcgaacaacctttctctcatcatggtgggaca
aaagtgttaagcggtaacctgggccgtgcggttatgaaaacctctgccgtgccggttgag
aaccaggtgattgaagcgccagcggttgtttttgaaagccagcatgacgttatgccggcc
tttgaagcgggtttgctggaccgcgattgtgtcgttgttgtccgtcatcaggggccaaaa
gcgaacggaatgccagaattacataaactcatgccgccacttggtgtattattggaccgg
tgtttcaaaattgcgttagttaccgatggacgactctccggcgcttcaggtaaagtgccg
tcagctatccacgtaacaccagaagcctacgatggcgggctgctggcaaaagtgcgcgac
ggggacatcattcgtgtgaatggacagacaggcgaactgacgctgctggtagacgaagcg
gaactggctgctcgcgaaccgcacattcctgacctgagcgcgtcacgcgtgggaacagga
cgtgaattattcagcgccttgcgtgaaaaactgtccggtgccgaacagggcgcaacctgt
atcactttttaa
              
                            

Download fasta file
RegulonDB