RegulonDB RegulonDB 10.8: Gene Sequence
eno gene sequence


Size: 1299        A: 354  T: 291  G: 334  C: 320

Fasta

 

>eno E. coli K12. Version NC_000913.3 GI:556503834
atgtccaaaatcgtaaaaatcatcggtcgtgaaatcatcgactcccgtggtaacccgact
gttgaagccgaagtacatctggagggtggtttcgtcggtatggcagctgctccgtcaggt
gcttctactggttcccgtgaagctctggaactgcgcgatggcgacaaatcccgtttcctg
ggtaaaggcgtaaccaaagctgttgctgcggtaaacggcccgatcgctcaggcgctgatt
ggcaaagatgctaaagatcaggctggcattgacaagatcatgatcgacctggacggcacc
gaaaacaaatccaaattcggcgcgaacgcaatcctggctgtatctctggctaacgccaaa
gctgctgcagctgctaaaggtatgccgctgtacgagcacatcgctgaactgaacggtact
ccgggcaaatactctatgccggttccgatgatgaacatcatcaacggtggtgagcacgct
gacaacaacgttgatatccaggaattcatgattcagccggttggcgcgaaaactgtgaaa
gaagccatccgcatgggttctgaagttttccatcacctggcaaaagttctgaaagcgaaa
ggcatgaacactgctgttggtgacgaaggtggctatgcgccgaacctgggttccaacgct
gaagctctggctgttatcgctgaagctgttaaagctgctggttatgaactgggcaaagac
atcactttggcgatggactgcgcagcttctgaattctacaaagatggtaaatacgttctg
gctggcgaaggcaacaaagcgttcacctctgaagaattcactcacttcctggaagaactg
accaaacagtacccgatcgtttctatcgaagacggtctggacgaatctgactgggacggt
ttcgcataccagaccaaagttctgggcgacaaaatccagctggttggtgacgacctgttc
gtaaccaacaccaagatcctgaaagaaggtatcgaaaaaggtatcgctaactccatcctg
atcaaattcaaccagatcggttctctgaccgaaactctggctgcaatcaagatggcgaaa
gatgctggctacactgcagttatctctcaccgttctggcgaaactgaagacgctaccatc
gctgacctggctgttggtactgctgcaggccagatcaaaactggttctatgagccgttct
gaccgtgttgctaaatacaaccagctgattcgtatcgaagaagctctgggcgaaaaagca
ccgtacaacggtcgtaaagagatcaaaggccaggcataa
              
                            

Download fasta file
RegulonDB