RegulonDB RegulonDB 10.8: Gene Sequence
entF gene sequence


Size: 3882        A: 816  T: 871  G: 1145  C: 1050

Fasta

 

>entF E. coli K12. Version NC_000913.3 GI:556503834
atgagccagcatttacctttggtcgccgcacagcccggcatctggatggcagaaaaactg
tcagaattaccctccgcctggagcgtggcgcattacgttgagttaaccggagaggttgat
tcgccattactggcccgcgcggtggttgccggactagcgcaagcagatacgctgcggatg
cgttttacggaagataacggcgaagtctggcagtgggtcgatgatgcgctgacgttcgaa
ctgccagaaattatcgacctacgaaccaacattgatccgcacggtactgcgcaggcatta
atgcaggcggatttgcaacaagatctgcgcgtcgatagcggtaaaccactggtctttcat
cagctgatacaggtggcggataaccgctggtactggtatcagcgttatcaccatttgctg
gtcgatggctttagtttcccggccattacccgccagatcgccaatatttactgcacatgg
ctgcgtggcgaaccaacgcctgcttcgccatttacgcctttcgctgatgtagtggaagag
taccagcaataccgcgaaagcgaagcctggcagcgtgatgcggcattctgggcagaacag
cgtcgtcaactgccgccgcccgcgtcactttctccggcacctttaccggggcgcagcgcc
tcggcagatattctgcgcctgaaactggaatttaccgacggggaattccgccagctggct
acgcaactttcaggtgtgcagcgtaccgatttagcccttgcgctggcagccttgtggctg
gggcgattgtgcaatcgtatggactacgccgccggatttatctttatgcgtcgactgggc
tcggcggcgctgacggctaccggacccgtgctcaacgttttgccgttgggtattcacatt
gcggcgcaagaaacgctgccggaactggcaacccgactggcagcacaactgaaaaaaatg
cgtcgtcatcaacgttacgatgccgaacaaattgtccgtgacagcgggcgagcggcaggt
gatgaaccgctgtttggtccggtactcaatatcaaggtatttgattaccaactggatatt
cctgatgttcaggcgcaaacccataccctggcaaccggtccggttaatgaccttgaactg
gccctgttcccggatgtacacggtgatttgagtattgagatcctcgccaataaacagcgt
tacgatgagccaacgttaatccagcatgctgaacgcctgaaaatgctgattgcccagttc
gccgcggatccggcgctgttgtgcggcgatgtcgatattatgctgccaggtgagtatgcg
cagctggcgcagctcaacgccactcaggttgagattccagaaaccacgcttagcgcgctg
gtggcagaacaagcggcaaaaacaccggatgctccggcgctggcagatgcgcgttacctg
ttcagctatcgggaaatgcgcgagcaggtggtggcgctggcgaatctgctgcgtgagcgc
ggcgttaaaccaggggacagcgtggcggtggcactaccgcgctcggtctttttgaccctg
gcactccatgcgatagttgaagctggagcggcctggctaccgctggataccggctatccg
gacgatcgcctgaaaatgatgctggaagatgcgcgtccgtcgctgttaattaccaccgac
gatcaactgccgcgctttagcgatgttcccaatttaacaagcctttgctataacgccccg
cttacaccgcagggcagtgcgccgctgcaactttcacaaccgcatcacacggcttatatc
atctttacctctggctccaccggcaggccgaaaggggtaatggtcgggcagacggctatc
gtcaaccgcctgctttggatgcaaaatcattatccgcttacaggcgaagatgtcgttgcc
caaaaaacgccgtgcagttttgatgtctcggtgtgggagtttttctggccgtttatcgca
ggggcaaaactggtgatggctgaaccggaagcgcaccgcgacccgctcgctatgcagcaa
ttctttgccgaatatggcgtaacgaccacgcactttgtgccgtcgatgctggcggcattt
gttgcctcgctgacgccgcaaaccgctcgccagagttgcgcgacgttgaaacaggttttc
tgtagtggtgaggccttaccggctgatttatgccgcgaatggcaacagttaactggcgcg
ccgttgcataatctatatggcccgacggaagcggcggtagatgtcagctggtatccggct
tttggcgaggaactggcacaggtgcgcggcagcagtgtgccgattggttatccggtatgg
aatacgggtctgcgtattcttgatgcgatgatgcatccggtgccgccgggtgtggcgggt
gatctctatctcactggcattcaactggcgcagggctatctcggacgccccgatctgacc
gccagccgctttattgccgatccttttgccccaggtgaacggatgtaccgtaccggagac
gttgcccgctggctggataacggcgcggtggagtacctcgggcgcagtgatgatcagcta
aaaattcgcgggcagcgtatcgaactgggcgaaatcgatcgcgtgatgcaggcgctgccg
gatgtcgaacaagccgttacccacgcctgtgtgattaaccaggcggctgccaccggtggt
gatgcgcgtcaattggtgggctatctggtgtcgcaatcgggcctgccgttggataccagc
gcattgcaggcgcagcttcgtgaaacattgccaccacatatggtaccggtggttctgctg
caacttccacagttaccacttagcgccaacggcaagctggatcgcaaagccttaccgttg
cctgaactgaaggcacaagcgccagggcgtgcgccgaaagcgggcagtgaaacgattatc
gccgcggcattctcgtcgttgctggggtgtgacgtgcaggatgccgatgctgatttcttc
gcgcttggcggtcattcgctactggcaatgaaactggcagcgcagttaagtcggcaggtt
gcccgccaggtgacgccggggcaagtgatggtcgcgtcaactgtcgccaaactggcaacg
attattgatgctgaagaagacagcacccggcgtatgggattcgaaaccattctgccgttg
cgtgaaggtaatggcccgacgctgttttgtttccatcctgcgtccggttttgcctggcag
ttcagcgtgctctcgcgttatctcgatccacaatggtcgattatcggcattcagtcaccg
cgccccaatggccccatgcagacggcggcaaacctggatgaagtctgcgaagcgcatctg
gcaacgttacttgaacaacaaccgcatggcccttattacctgctggggtattcccttggc
ggtacgctggcgcagggtattgcggcgcgactgcgtgcccgtggcgaacaggtggcattt
cttggcttgctggatacctggccgccagaaacgcaaaactggcaggaaaaagaagctaat
ggtctggacccggaagtgctggcggagattaaccgcgaacgcgaggccttcctggcagca
cagcagggaagtacttcaacggagttgtttaccaccattgaaggcaactacgctgatgct
gtgcgcctgctgacgactgctcatagcgtaccgtttgacggtaaagcgacgctgtttgtt
gctgaacgcacacttcaggaaggtatgagtcccgaacgcgcctggtcgccgtggatagcg
gagctggatatctatcgtcaggattgtgcgcatgtggatattatctctccagggacgttt
gaaaaaattgggccgattattcgcgcaacgctaaacaggtaa
              
                            

Download fasta file
RegulonDB