RegulonDB RegulonDB 11.1: Gene Sequence
envZ gene sequence


Size: 1353        A: 285  T: 296  G: 423  C: 349

Fasta

 

>envZ E. coli K12. Version NC_000913.3 GI:556503834
atgaggcgattgcgcttctcgccacgaagttcatttgcccgtacgttattgctcatcgtc
accttgctgttcgccagcctggtgacgacttatctggtggtgctgaacttcgcgattttg
ccgagcctccagcagtttaataaagtcctcgcgtacgaagtgcgtatgttgatgaccgac
aaactgcaactggaggacggcacgcagttggttgtgcctcccgctttccgtcgggagatc
taccgtgagctggggatctctctctactccaacgaggctgccgaagaggcaggtctgcgt
tgggcgcaacactatgaattcttaagccatcagatggcgcagcaactgggcggcccgacg
gaagtgcgcgttgaggtcaacaaaagttcgcctgtcgtctggctgaaaacctggctgtcg
cccaatatctgggtacgcgtgccgctgaccgaaattcatcagggcgatttctctccgctg
ttccgctatacgctggcgattatgctattggcgataggcggggcgtggctgtttattcgt
atccagaaccgaccgttggtcgatctcgaacacgcagccttgcaggttggtaaagggatt
attccgccgccgctgcgtgagtatggcgcttcggaggtgcgttccgttacccgtgccttt
aaccatatggcggctggtgttaagcaactggcggatgaccgcacgctgctgatggcgggg
gtaagtcacgacttgcgcacgccgctgacgcgtattcgcctggcgactgagatgatgagc
gagcaggatggctatctggcagaatcgatcaataaagatatcgaagagtgcaacgccatc
attgagcagtttatcgactacctgcgcaccgggcaggagatgccgatggaaatggcggat
cttaatgcagtactcggtgaggtgattgctgccgaaagtggctatgagcgggaaattgaa
accgcgctttaccccggcagcattgaagtgaaaatgcacccgctgtcgatcaaacgcgcg
gtggcgaatatggtggtcaacgccgcccgttatggcaatggctggatcaaagtcagcagc
ggaacggagccgaatcgcgcctggttccaggtggaagatgacggtccgggaattgcgccg
gaacaacgtaagcacctgttccagccgtttgtccgcggcgacagtgcgcgcaccattagc
ggcacgggattagggctggcaattgtgcagcgtatcgtggataaccataacgggatgctg
gagcttggcaccagcgagcggggcgggctttccattcgcgcctggctgccagtgccggta
acgcgggcgcagggcacgacaaaagaagggtaa
              
                            

Download fasta file
RegulonDB