RegulonDB RegulonDB 10.8: Gene Sequence
fabA gene sequence


Size: 519        A: 118  T: 125  G: 157  C: 119

Fasta

 

>fabA E. coli K12. Version NC_000913.3 GI:556503834
atggtagataaacgcgaatcctatacaaaagaagaccttcttgcctctggtcgcggtgaa
ctgtttggcgctaaaggcccgcaattgccagcaccgaacatgctgatgatggaccgtgtg
gtcaaaatgaccgaaacgggtggtaacttcgacaaagggtatgttgaagcagaactggat
atcaatccggatctgtggttcttcggatgccactttattggcgatccggttatgccggga
tgcctgggcctggacgcaatgtggcagctggtagggttctacctcggctggctgggcggc
gaaggtaaaggccgcgcgctgggcgttggcgaagtgaaattcactggtcaggtactgccg
acagcgaaaaaagtgacctaccgtattcactttaaacgcattgttaaccgtcgtctgatt
atgggcctggcggatggcgaagtgctggttgatggtcgtctgatctataccgccagcgac
ctgaaagtcggtctgttccaggatacgtctgccttctga
              
                            

Download fasta file
RegulonDB