RegulonDB RegulonDB 10.10: Gene Sequence
fabB gene sequence


Size: 1221        A: 262  T: 268  G: 353  C: 338

Fasta

 

>fabB E. coli K12. Version NC_000913.3 GI:556503834
atgaaacgtgcagtgattactggcctgggcattgtttccagcatcggtaataaccagcag
gaagtcctggcatctctgcgtgaaggacgttcagggatcactttctctcaggagctgaag
gattccggcatgcgtagccacgtctggggcaacgtaaaactggataccactggcctcatt
gaccgcaaagttgtgcgctttatgagcgacgcatccatttatgcattcctttctatggag
caggcaatcgctgatgcgggcctctctccggaagcttaccagaataacccgcgcgttggc
ctgattgcaggttccggcggcggctccccgcgtttccaggtgttcggcgctgacgcaatg
cgcggcccgcgcggcctgaaagcggttggcccgtatgtggtcaccaaagcgatggcatcc
ggcgtttctgcctgcctcgccaccccgtttaaaattcatggcgttaactactccatcagc
tccgcgtgtgcgacttccgcacactgtatcggtaacgcagtagagcagatccaactgggc
aaacaggacatcgtgtttgctggcggcggcgaagagctgtgctgggaaatggcttgcgaa
ttcgacgcaatgggtgcgctgtctactaaatacaacgacaccccggaaaaagcctcccgt
acttacgacgctcaccgtgacggtttcgttatcgctggcggcggcggtatggtagtggtt
gaagagctggaacacgcgctggcgcgtggtgctcacatctatgctgaaatcgttggctac
ggcgcaacctctgatggtgcagacatggttgctccgtctggcgaaggcgcagtacgctgc
atgaagatggcgatgcatggcgttgataccccaatcgattacctgaactcccacggtact
tcgactccggttggcgacgtgaaagagctggcagctatccgtgaagtgttcggcgataag
agcccggcgatttctgcaaccaaagccatgaccggtcactctctgggcgctgctggcgta
caggaagctatctactctctgctgatgctggaacacggctttatcgccccgagcatcaac
attgaagagctggacgagcaggctgcgggtctgaacatcgtgaccgaaacgaccgatcgc
gaactgaccaccgttatgtctaacagcttcggcttcggcggcaccaacgccacgctggta
atgcgcaagctgaaagattaa
              
                            

Download fasta file
RegulonDB