RegulonDB RegulonDB 10.10: Gene Sequence
fadL gene sequence


Size: 1341        A: 329  T: 344  G: 333  C: 335

Fasta

 

>fadL E. coli K12. Version NC_000913.3 GI:556503834
atgagccagaaaaccctgtttacaaagtctgctctcgcagtcgcagtggcacttatctcc
acccaggcctggtcggcaggctttcagttaaacgaattttcttcctctggcctgggccgg
gcttattcaggggaaggcgcaattgccgatgatgcaggtaacgtcagccgtaaccccgca
ttgattactatgtttgaccgcccgacattttctgcgggtgcggtttatattgacccggat
gtaaatatcagcggaacgtctccatctggtcgtagcctgaaagccgataacatcgcgcct
acggcatgggttccgaacatgcactttgttgcaccgattaacgaccaatttggttggggc
gcttctattacctctaactatggtctggctacagagtttaacgatacttatgcaggcggc
tctgtcgggggtacaaccgaccttgaaaccatgaacctgaacttaagcggtgcgtatcgc
ttaaataatgcatggagctttggtcttggtttcaacgccgtctacgctcgcgcgaaaatt
gaacgtttcgcaggcgatctggggcagttggttgctggccaaattatgcaatctcctgct
ggccaaactcagcaagggcaagcattggcagctaccgccaacggtattgacagtaatacc
aaaatcgctcatctgaacggtaaccagtggggctttggctggaacgccggaatcctgtat
gaactggataaaaataaccgctatgcactgacctaccgttctgaagtgaaaattgacttc
aaaggtaactacagcagcgatcttaatcgtgcgtttaataactacggtttgccaattcct
accgcgacaggtggcgcaacgcaatcgggttatctgacgctgaacctgcctgaaatgtgg
gaagtgtcaggttataaccgtgttgatccacagtgggcgattcactatagcctggcttac
accagctggagtcagttccagcagctgaaagcgacctcaaccagtggcgacacgctgttc
cagaaacatgaaggctttaaagatgcttaccgcatcgcgttgggtaccacttattactac
gatgataactggaccttccgtaccggtatcgcctttgatgacagcccagttcctgcacag
aatcgttctatctccattccggaccaggaccgtttctggctgagtgcaggtacgacttac
gcatttaataaagatgcttcagtcgacgttggtgtttcttatatgcacggtcagagcgtg
aaaattaacgaaggcccataccagttcgagtctgaaggtaaagcctggctgttcggtact
aactttaactacgcgttctga
              
                            

Download fasta file
RegulonDB